Variant ID: vg0513235168 (JBrowse) | Variation Type: SNP |
Chromosome: chr05 | Position: 13235168 |
Reference Allele: A | Alternative Allele: T |
Primary Allele: A | Secondary Allele: T |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 92. )
TATGCACCTTTTTAAATTAGTAGAACAGTATATACCTTTTTTAAGTTAGTAGCGGTATGTACCTTTTTAAATTATTAGAACAGTATATACCTTTTAAGTT[A/T]
GTAGCGGTATATATACTTCTTTTAAAGTTAGTATCAGTATATACTGTTTTTTTTTCTTAAGGTAGTGGCAGTATATACTTCTAAGTTAGTAGGGAGGATA
TATCCTCCCTACTAACTTAGAAGTATATACTGCCACTACCTTAAGAAAAAAAAACAGTATATACTGATACTAACTTTAAAAGAAGTATATATACCGCTAC[T/A]
AACTTAAAAGGTATATACTGTTCTAATAATTTAAAAAGGTACATACCGCTACTAACTTAAAAAAGGTATATACTGTTCTACTAATTTAAAAAGGTGCATA
Populations | Population Size | Frequency of A(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
---|---|---|---|---|---|---|
All | 4726 | 96.40% | 3.30% | 0.32% | 0.00% | NA |
All Indica | 2759 | 93.80% | 5.60% | 0.54% | 0.00% | NA |
All Japonica | 1512 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Indica I | 595 | 86.70% | 12.60% | 0.67% | 0.00% | NA |
Indica II | 465 | 96.80% | 2.60% | 0.65% | 0.00% | NA |
Indica III | 913 | 96.80% | 2.80% | 0.33% | 0.00% | NA |
Indica Intermediate | 786 | 94.00% | 5.30% | 0.64% | 0.00% | NA |
Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Intermediate | 90 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
---|---|---|---|---|---|---|---|---|---|
vg0513235168 | A -> T | LOC_Os05g23194.1 | upstream_gene_variant ; 4453.0bp to feature; MODIFIER | silent_mutation | Average:43.62; most accessible tissue: Zhenshan97 flower, score: 57.454 | N | N | N | N |
vg0513235168 | A -> T | LOC_Os05g23200.1 | downstream_gene_variant ; 238.0bp to feature; MODIFIER | silent_mutation | Average:43.62; most accessible tissue: Zhenshan97 flower, score: 57.454 | N | N | N | N |
vg0513235168 | A -> T | LOC_Os05g23210.1 | downstream_gene_variant ; 4414.0bp to feature; MODIFIER | silent_mutation | Average:43.62; most accessible tissue: Zhenshan97 flower, score: 57.454 | N | N | N | N |
vg0513235168 | A -> T | LOC_Os05g23194-LOC_Os05g23200 | intergenic_region ; MODIFIER | silent_mutation | Average:43.62; most accessible tissue: Zhenshan97 flower, score: 57.454 | N | N | N | N |
Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
---|---|---|---|---|---|---|
vg0513235168 | NA | 1.28E-06 | mr1125 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0513235168 | 1.91E-06 | NA | mr1397_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0513235168 | 1.02E-06 | 8.45E-06 | mr1397_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0513235168 | NA | 8.56E-06 | mr1864_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0513235168 | NA | 9.11E-06 | mr1974_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |