Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0512828870:

Variant ID: vg0512828870 (JBrowse)	Variation Type: SNP
Chromosome: chr05	Position: 12828870
Reference Allele: G	Alternative Allele: C
Primary Allele: G	Secondary Allele: C

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, C: 0.01, others allele: 0.00, population size: 126. )

Flanking Sequence (100 bp) in Reference Genome:

AGAGGAGCAAAATATATTGCCACTGATTATTTATTGTATTGTGGCACTAGGCAGGATTCAGCTTGTGAGTAAAAAAATTGTATAATTACATTTGTACCAA[G/C]
AAAGCCACGTGTTTATGATAAAAAATTTAGCATGCTGTTAGTCTAGATATGTTTTATATCTCCTAAATTTATGCCTTGTCCAGGGCAAGTTACTGGCTTT

Reverse complement sequence

AAAGCCAGTAACTTGCCCTGGACAAGGCATAAATTTAGGAGATATAAAACATATCTAGACTAACAGCATGCTAAATTTTTTATCATAAACACGTGGCTTT[C/G]
TTGGTACAAATGTAATTATACAATTTTTTTACTCACAAGCTGAATCCTGCCTAGTGCCACAATACAATAAATAATCAGTGGCAATATATTTTGCTCCTCT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	89.90%	7.70%	2.35%	0.00%	NA
All Indica	2759	84.30%	12.20%	3.44%	0.00%	NA
All Japonica	1512	97.90%	1.30%	0.86%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	73.30%	17.80%	8.91%	0.00%	NA
Indica II	465	76.80%	19.10%	4.09%	0.00%	NA
Indica III	913	94.60%	4.80%	0.55%	0.00%	NA
Indica Intermediate	786	85.20%	12.50%	2.29%	0.00%	NA
Temperate Japonica	767	97.10%	2.20%	0.65%	0.00%	NA
Tropical Japonica	504	99.60%	0.20%	0.20%	0.00%	NA
Japonica Intermediate	241	96.70%	0.40%	2.90%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	85.60%	11.10%	3.33%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0512828870	G -> C	LOC_Os05g22590.1	upstream_gene_variant ; 3893.0bp to feature; MODIFIER	silent_mutation	Average:50.392; most accessible tissue: Zhenshan97 flag leaf, score: 63.67	N	N	N	N
vg0512828870	G -> C	LOC_Os05g22614.1	downstream_gene_variant ; 4589.0bp to feature; MODIFIER	silent_mutation	Average:50.392; most accessible tissue: Zhenshan97 flag leaf, score: 63.67	N	N	N	N
vg0512828870	G -> C	LOC_Os05g22614.3	downstream_gene_variant ; 4589.0bp to feature; MODIFIER	silent_mutation	Average:50.392; most accessible tissue: Zhenshan97 flag leaf, score: 63.67	N	N	N	N
vg0512828870	G -> C	LOC_Os05g22600.1	intron_variant ; MODIFIER	silent_mutation	Average:50.392; most accessible tissue: Zhenshan97 flag leaf, score: 63.67	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0512828870	1.89E-06	NA	mr1593_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0512828870	1.08E-06	NA	mr1593_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251