Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0511189064:

Variant ID: vg0511189064 (JBrowse)	Variation Type: SNP
Chromosome: chr05	Position: 11189064
Reference Allele: A	Alternative Allele: G
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 272. )

Flanking Sequence (100 bp) in Reference Genome:

AAATATGCCGATTTATGACCATATTTCCAACAGATATAAGCATAATTAGCATACTATGACACCAGTAAATACGTTATAACACCAATGAATCAATTTTCTG[A/G]
TCCGCTCCTTACCGCAATGAATGAGATGAAAACATATTAGTACGATCAGAAAATCGCGTGGAAAAAATTACGCGGACGGTCAAAAACAGATTACGAGGAA

Reverse complement sequence

TTCCTCGTAATCTGTTTTTGACCGTCCGCGTAATTTTTTCCACGCGATTTTCTGATCGTACTAATATGTTTTCATCTCATTCATTGCGGTAAGGAGCGGA[T/C]
CAGAAAATTGATTCATTGGTGTTATAACGTATTTACTGGTGTCATAGTATGCTAATTATGCTTATATCTGTTGGAAATATGGTCATAAATCGGCATATTT

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	83.90%	14.50%	1.46%	0.13%	NA
All Indica	2759	74.80%	22.70%	2.25%	0.22%	NA
All Japonica	1512	99.40%	0.40%	0.20%	0.00%	NA
Aus	269	83.60%	16.00%	0.37%	0.00%	NA
Indica I	595	87.70%	10.10%	1.85%	0.34%	NA
Indica II	465	72.90%	24.50%	2.58%	0.00%	NA
Indica III	913	69.70%	28.80%	1.31%	0.22%	NA
Indica Intermediate	786	72.30%	24.00%	3.44%	0.25%	NA
Temperate Japonica	767	99.30%	0.40%	0.26%	0.00%	NA
Tropical Japonica	504	99.60%	0.40%	0.00%	0.00%	NA
Japonica Intermediate	241	99.20%	0.40%	0.41%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	86.70%	10.00%	3.33%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0511189064	A -> DEL	N	N	silent_mutation	Average:87.216; most accessible tissue: Zhenshan97 young leaf, score: 89.875	N	N	N	N
vg0511189064	A -> G	LOC_Os05g19270.1	upstream_gene_variant ; 351.0bp to feature; MODIFIER	silent_mutation	Average:87.216; most accessible tissue: Zhenshan97 young leaf, score: 89.875	N	N	N	N
vg0511189064	A -> G	LOC_Os05g19250.1	downstream_gene_variant ; 2574.0bp to feature; MODIFIER	silent_mutation	Average:87.216; most accessible tissue: Zhenshan97 young leaf, score: 89.875	N	N	N	N
vg0511189064	A -> G	LOC_Os05g19260.1	downstream_gene_variant ; 1658.0bp to feature; MODIFIER	silent_mutation	Average:87.216; most accessible tissue: Zhenshan97 young leaf, score: 89.875	N	N	N	N
vg0511189064	A -> G	LOC_Os05g19260-LOC_Os05g19270	intergenic_region ; MODIFIER	silent_mutation	Average:87.216; most accessible tissue: Zhenshan97 young leaf, score: 89.875	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0511189064	NA	7.64E-06	mr1014	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0511189064	NA	7.96E-08	mr1015	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0511189064	NA	1.03E-06	mr1031	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0511189064	NA	6.56E-06	mr1034	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0511189064	NA	2.12E-06	mr1532	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0511189064	NA	3.67E-06	mr1678	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0511189064	7.62E-06	NA	mr1897	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0511189064	9.57E-06	2.70E-06	mr1897	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251