Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0510448104:

Variant ID: vg0510448104 (JBrowse)	Variation Type: SNP
Chromosome: chr05	Position: 10448104
Reference Allele: G	Alternative Allele: A,T
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 286. )

Flanking Sequence (100 bp) in Reference Genome:

TAGATGAGTCTGGTTCTCGTTTGCTTACTTTGCAATTTCTGTGCACTTTGAAAGAAATAGAAGATGGTATTTCTTTTCGCCTTTTCCGTAAGGAGTTCAC[G/A,T]
CTCACATGGAAAGGCTTGAGTACACTTCTTGTTTTTCACGATTCCTTTAAAATCGATCTCCAGAAAGGAATTTCTTGGTTCAAGAAAAATAGGTTTTGGG

Reverse complement sequence

CCCAAAACCTATTTTTCTTGAACCAAGAAATTCCTTTCTGGAGATCGATTTTAAAGGAATCGTGAAAAACAAGAAGTGTACTCAAGCCTTTCCATGTGAG[C/T,A]
GTGAACTCCTTACGGAAAAGGCGAAAAGAAATACCATCTTCTATTTCTTTCAAAGTGCACAGAAATTGCAAAGTAAGCAAACGAGAACCAGACTCATCTA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	97.30%	2.30%	0.44%	0.00%	NA
All Indica	2759	95.40%	3.80%	0.76%	0.00%	NA
All Japonica	1512	99.90%	0.10%	0.00%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	99.70%	0.00%	0.34%	0.00%	NA
Indica II	465	76.80%	20.20%	3.01%	0.00%	NA
Indica III	913	99.90%	0.10%	0.00%	0.00%	NA
Indica Intermediate	786	98.00%	1.40%	0.64%	0.00%	NA
Temperate Japonica	767	99.90%	0.10%	0.00%	0.00%	NA
Tropical Japonica	504	100.00%	0.00%	0.00%	0.00%	NA
Japonica Intermediate	241	100.00%	0.00%	0.00%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	98.90%	1.10%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0510448104	G -> T	LOC_Os05g18180.1	synonymous_variant ; p.Thr103Thr; LOW	N	Average:26.24; most accessible tissue: Zhenshan97 flag leaf, score: 46.427	N	N	N	N
vg0510448104	G -> T	LOC_Os05g18190.1	upstream_gene_variant ; 4058.0bp to feature; MODIFIER	N	Average:26.24; most accessible tissue: Zhenshan97 flag leaf, score: 46.427	N	N	N	N
vg0510448104	G -> T	LOC_Os05g18170.1	downstream_gene_variant ; 1011.0bp to feature; MODIFIER	N	Average:26.24; most accessible tissue: Zhenshan97 flag leaf, score: 46.427	N	N	N	N
vg0510448104	G -> A	LOC_Os05g18180.1	synonymous_variant ; p.Thr103Thr; LOW	synonymous_codon	Average:26.24; most accessible tissue: Zhenshan97 flag leaf, score: 46.427	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0510448104	1.58E-09	9.58E-36	mr1039	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0510448104	1.15E-06	1.09E-20	mr1039	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0510448104	9.59E-12	NA	mr1632	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0510448104	8.42E-10	1.60E-12	mr1632	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0510448104	1.58E-15	3.65E-42	mr1039_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0510448104	1.40E-10	4.07E-24	mr1039_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0510448104	5.80E-07	NA	mr1514_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0510448104	3.52E-06	5.01E-06	mr1514_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0510448104	1.09E-18	2.85E-34	mr1632_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0510448104	4.26E-14	4.21E-22	mr1632_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251