Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0509049542:

Variant ID: vg0509049542 (JBrowse)	Variation Type: SNP
Chromosome: chr05	Position: 9049542
Reference Allele: C	Alternative Allele: A,T
Primary Allele: C	Secondary Allele: A

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 241. )

Flanking Sequence (100 bp) in Reference Genome:

ATCGTGAGCTACCTTTACCATGTACATCATTAAGTAACAGTGAAACATTAGTTATCCCAATAGTGTGCTAATGTTTCTAAGCATGGCTAAGCAATTATAT[C/A,T]
TAATATATCTAGTTGAACCAATATATAAATCCAATTAGTCAAATTATAACCCAAGGTAATCAAGAAATAGGGTAATCAATGCAAATTGGCCATAACAAAG

Reverse complement sequence

CTTTGTTATGGCCAATTTGCATTGATTACCCTATTTCTTGATTACCTTGGGTTATAATTTGACTAATTGGATTTATATATTGGTTCAACTAGATATATTA[G/T,A]
ATATAATTGCTTAGCCATGCTTAGAAACATTAGCACACTATTGGGATAACTAATGTTTCACTGTTACTTAATGATGTACATGGTAAAGGTAGCTCACGAT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	75.40%	18.60%	4.30%	1.76%	NA
All Indica	2759	65.30%	24.90%	6.78%	2.97%	NA
All Japonica	1512	99.70%	0.20%	0.07%	0.00%	NA
Aus	269	29.00%	66.50%	4.46%	0.00%	NA
Indica I	595	85.70%	8.10%	4.87%	1.34%	NA
Indica II	465	68.20%	22.40%	6.67%	2.80%	NA
Indica III	913	46.00%	41.30%	7.67%	5.04%	NA
Indica Intermediate	786	70.60%	20.20%	7.25%	1.91%	NA
Temperate Japonica	767	99.90%	0.10%	0.00%	0.00%	NA
Tropical Japonica	504	99.60%	0.20%	0.20%	0.00%	NA
Japonica Intermediate	241	99.60%	0.40%	0.00%	0.00%	NA
VI/Aromatic	96	99.00%	0.00%	1.04%	0.00%	NA
Intermediate	90	88.90%	7.80%	2.22%	1.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0509049542	C -> T	LOC_Os05g16020.1	upstream_gene_variant ; 2822.0bp to feature; MODIFIER	N	Average:33.859; most accessible tissue: Minghui63 flag leaf, score: 50.629	N	N	N	N
vg0509049542	C -> T	LOC_Os05g16030.1	downstream_gene_variant ; 4368.0bp to feature; MODIFIER	N	Average:33.859; most accessible tissue: Minghui63 flag leaf, score: 50.629	N	N	N	N
vg0509049542	C -> T	LOC_Os05g16010-LOC_Os05g16020	intergenic_region ; MODIFIER	N	Average:33.859; most accessible tissue: Minghui63 flag leaf, score: 50.629	N	N	N	N
vg0509049542	C -> DEL	N	N	silent_mutation	Average:33.859; most accessible tissue: Minghui63 flag leaf, score: 50.629	N	N	N	N
vg0509049542	C -> A	LOC_Os05g16020.1	upstream_gene_variant ; 2822.0bp to feature; MODIFIER	silent_mutation	Average:33.859; most accessible tissue: Minghui63 flag leaf, score: 50.629	N	N	N	N
vg0509049542	C -> A	LOC_Os05g16030.1	downstream_gene_variant ; 4368.0bp to feature; MODIFIER	silent_mutation	Average:33.859; most accessible tissue: Minghui63 flag leaf, score: 50.629	N	N	N	N
vg0509049542	C -> A	LOC_Os05g16010-LOC_Os05g16020	intergenic_region ; MODIFIER	silent_mutation	Average:33.859; most accessible tissue: Minghui63 flag leaf, score: 50.629	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0509049542	NA	2.59E-30	mr1039	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0509049542	NA	1.51E-15	mr1039	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0509049542	4.76E-07	NA	mr1632	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0509049542	NA	2.03E-11	mr1632	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0509049542	NA	1.34E-27	mr1039_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0509049542	NA	6.38E-14	mr1039_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0509049542	NA	4.83E-11	mr1632_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251