Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0508975741:

Variant ID: vg0508975741 (JBrowse)	Variation Type: SNP
Chromosome: chr05	Position: 8975741
Reference Allele: A	Alternative Allele: C
Primary Allele: A	Secondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.91, A: 0.10, others allele: 0.00, population size: 204. )

Flanking Sequence (100 bp) in Reference Genome:

CAAGAGGCTCTATTGTATTATTTGTATACTAGAATTAGGAAGATAGTAGAGTAGAAGAAGTCGGAGGAATTCCGGAGCTGTCGGTAATCCTCTCCTGTTT[A/C]
TTTTATTCTGTTTATTACTCTAATACCATAGGATTATCTTCCTGAGTAATTTAGATTTATCTTGTGAGAATTACCTCTTGGTTAGTTCCTAATTAGCATA

Reverse complement sequence

TATGCTAATTAGGAACTAACCAAGAGGTAATTCTCACAAGATAAATCTAAATTACTCAGGAAGATAATCCTATGGTATTAGAGTAATAAACAGAATAAAA[T/G]
AAACAGGAGAGGATTACCGACAGCTCCGGAATTCCTCCGACTTCTTCTACTCTACTATCTTCCTAATTCTAGTATACAAATAATACAATAGAGCCTCTTG

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	72.30%	27.50%	0.04%	0.21%	NA
All Indica	2759	61.40%	38.10%	0.07%	0.36%	NA
All Japonica	1512	99.20%	0.80%	0.00%	0.00%	NA
Aus	269	20.80%	79.20%	0.00%	0.00%	NA
Indica I	595	85.00%	14.80%	0.17%	0.00%	NA
Indica II	465	66.90%	32.30%	0.00%	0.86%	NA
Indica III	913	39.40%	60.20%	0.00%	0.33%	NA
Indica Intermediate	786	65.90%	33.60%	0.13%	0.38%	NA
Temperate Japonica	767	99.90%	0.10%	0.00%	0.00%	NA
Tropical Japonica	504	98.00%	2.00%	0.00%	0.00%	NA
Japonica Intermediate	241	99.60%	0.40%	0.00%	0.00%	NA
VI/Aromatic	96	99.00%	1.00%	0.00%	0.00%	NA
Intermediate	90	77.80%	22.20%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0508975741	A -> DEL	N	N	silent_mutation	Average:49.195; most accessible tissue: Minghui63 panicle, score: 59.629	N	N	N	N
vg0508975741	A -> C	LOC_Os05g15890.1	upstream_gene_variant ; 2432.0bp to feature; MODIFIER	silent_mutation	Average:49.195; most accessible tissue: Minghui63 panicle, score: 59.629	N	N	N	N
vg0508975741	A -> C	LOC_Os05g15900.1	upstream_gene_variant ; 1366.0bp to feature; MODIFIER	silent_mutation	Average:49.195; most accessible tissue: Minghui63 panicle, score: 59.629	N	N	N	N
vg0508975741	A -> C	LOC_Os05g15890.2	upstream_gene_variant ; 2432.0bp to feature; MODIFIER	silent_mutation	Average:49.195; most accessible tissue: Minghui63 panicle, score: 59.629	N	N	N	N
vg0508975741	A -> C	LOC_Os05g15890.3	upstream_gene_variant ; 2432.0bp to feature; MODIFIER	silent_mutation	Average:49.195; most accessible tissue: Minghui63 panicle, score: 59.629	N	N	N	N
vg0508975741	A -> C	LOC_Os05g15910.1	intron_variant ; MODIFIER	silent_mutation	Average:49.195; most accessible tissue: Minghui63 panicle, score: 59.629	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0508975741	7.15E-09	6.22E-29	mr1039	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0508975741	NA	1.42E-13	mr1039	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0508975741	NA	1.14E-08	mr1632	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0508975741	3.08E-07	NA	mr1039_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0508975741	NA	4.01E-12	mr1039_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0508975741	NA	7.39E-10	mr1632_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251