Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0507866014:

Variant ID: vg0507866014 (JBrowse)	Variation Type: SNP
Chromosome: chr05	Position: 7866014
Reference Allele: C	Alternative Allele: T
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.87, T: 0.14, others allele: 0.00, population size: 109. )

Flanking Sequence (100 bp) in Reference Genome:

GTAATATCGGCATTGGGAAAGAAGATTAGATTGAAGCGAAGTCGGAGGCGGAGATCGAGTTCGGAAACAGAGCAGGATCGGCTGGAGTCCAGATCGGCTA[C/T]
GATAAGATCAGCTGAGTCTGAGTCGGACTAGGTAAGCCGATGTAGCCGATCCTAGCAATACAACTTGATGTGTGATGTCAGGTTGGATTGAGGTCTTCAA

Reverse complement sequence

TTGAAGACCTCAATCCAACCTGACATCACACATCAAGTTGTATTGCTAGGATCGGCTACATCGGCTTACCTAGTCCGACTCAGACTCAGCTGATCTTATC[G/A]
TAGCCGATCTGGACTCCAGCCGATCCTGCTCTGTTTCCGAACTCGATCTCCGCCTCCGACTTCGCTTCAATCTAATCTTCTTTCCCAATGCCGATATTAC

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	53.80%	46.00%	0.21%	0.00%	NA
All Indica	2759	82.70%	17.00%	0.29%	0.00%	NA
All Japonica	1512	1.70%	98.30%	0.00%	0.00%	NA
Aus	269	72.50%	27.50%	0.00%	0.00%	NA
Indica I	595	95.80%	3.50%	0.67%	0.00%	NA
Indica II	465	68.20%	31.60%	0.22%	0.00%	NA
Indica III	913	80.90%	18.90%	0.11%	0.00%	NA
Indica Intermediate	786	83.60%	16.20%	0.25%	0.00%	NA
Temperate Japonica	767	1.80%	98.20%	0.00%	0.00%	NA
Tropical Japonica	504	2.00%	98.00%	0.00%	0.00%	NA
Japonica Intermediate	241	0.80%	99.20%	0.00%	0.00%	NA
VI/Aromatic	96	1.00%	99.00%	0.00%	0.00%	NA
Intermediate	90	42.20%	55.60%	2.22%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0507866014	C -> T	LOC_Os05g14070.1	upstream_gene_variant ; 2242.0bp to feature; MODIFIER	silent_mutation	Average:38.444; most accessible tissue: Zhenshan97 root, score: 51.776	N	N	N	N
vg0507866014	C -> T	LOC_Os05g14090.1	upstream_gene_variant ; 2189.0bp to feature; MODIFIER	silent_mutation	Average:38.444; most accessible tissue: Zhenshan97 root, score: 51.776	N	N	N	N
vg0507866014	C -> T	LOC_Os05g14080.1	downstream_gene_variant ; 274.0bp to feature; MODIFIER	silent_mutation	Average:38.444; most accessible tissue: Zhenshan97 root, score: 51.776	N	N	N	N
vg0507866014	C -> T	LOC_Os05g14080-LOC_Os05g14090	intergenic_region ; MODIFIER	silent_mutation	Average:38.444; most accessible tissue: Zhenshan97 root, score: 51.776	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0507866014	NA	5.77E-26	mr1039	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507866014	NA	2.85E-08	mr1514	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507866014	2.28E-06	7.42E-31	mr1632	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507866014	2.59E-07	4.85E-10	mr1632	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507866014	NA	7.62E-06	mr1832	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507866014	NA	1.19E-08	mr1986	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507866014	9.82E-06	9.02E-28	mr1039_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507866014	NA	1.42E-12	mr1514_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507866014	1.18E-06	2.07E-34	mr1632_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507866014	2.65E-06	5.13E-08	mr1632_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251