Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0507602235:

Variant ID: vg0507602235 (JBrowse)	Variation Type: SNP
Chromosome: chr05	Position: 7602235
Reference Allele: A	Alternative Allele: T,C
Primary Allele: A	Secondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GACCGGCGTACCTTGGCCAGTCTGAACGGCCGCAAGAAGGCGGTCTGACCGGCGCATAAAGCCGGTCTGACCGGCAGTACATGCGCGGTCAGACCGGCCC[A/T,C]
CTGGAGGCCGGGATGGTGCTGCTCCGGGTGGCCGATACAGAGCCGATGGAGCCGTAGTCGGTCAGACCGAGCCGATGGCGGTCTGACCGAGCCGAGGCCG

Reverse complement sequence

CGGCCTCGGCTCGGTCAGACCGCCATCGGCTCGGTCTGACCGACTACGGCTCCATCGGCTCTGTATCGGCCACCCGGAGCAGCACCATCCCGGCCTCCAG[T/A,G]
GGGCCGGTCTGACCGCGCATGTACTGCCGGTCAGACCGGCTTTATGCGCCGGTCAGACCGCCTTCTTGCGGCCGTTCAGACTGGCCAAGGTACGCCGGTC

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	56.20%	0.30%	6.03%	37.54%	T: 0.02%
All Indica	2759	31.30%	0.40%	10.15%	58.14%	T: 0.04%
All Japonica	1512	92.10%	0.10%	0.07%	7.74%	NA
Aus	269	86.20%	0.40%	0.74%	12.64%	NA
Indica I	595	22.20%	0.20%	3.36%	74.29%	NA
Indica II	465	42.20%	0.20%	14.41%	43.23%	NA
Indica III	913	29.10%	0.40%	13.80%	56.63%	NA
Indica Intermediate	786	34.40%	0.50%	8.52%	56.49%	T: 0.13%
Temperate Japonica	767	98.40%	0.00%	0.00%	1.56%	NA
Tropical Japonica	504	80.40%	0.00%	0.20%	19.44%	NA
Japonica Intermediate	241	96.70%	0.40%	0.00%	2.90%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	76.70%	0.00%	2.22%	21.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0507602235	A -> T	LOC_Os05g13730.1	upstream_gene_variant ; 1148.0bp to feature; MODIFIER	silent_mutation	Average:19.476; most accessible tissue: Callus, score: 46.945	N	N	N	N
vg0507602235	A -> T	LOC_Os05g13720.1	downstream_gene_variant ; 1660.0bp to feature; MODIFIER	silent_mutation	Average:19.476; most accessible tissue: Callus, score: 46.945	N	N	N	N
vg0507602235	A -> T	LOC_Os05g13720-LOC_Os05g13730	intergenic_region ; MODIFIER	silent_mutation	Average:19.476; most accessible tissue: Callus, score: 46.945	N	N	N	N
vg0507602235	A -> DEL	N	N	silent_mutation	Average:19.476; most accessible tissue: Callus, score: 46.945	N	N	N	N
vg0507602235	A -> C	LOC_Os05g13730.1	upstream_gene_variant ; 1148.0bp to feature; MODIFIER	silent_mutation	Average:19.476; most accessible tissue: Callus, score: 46.945	N	N	N	N
vg0507602235	A -> C	LOC_Os05g13720.1	downstream_gene_variant ; 1660.0bp to feature; MODIFIER	silent_mutation	Average:19.476; most accessible tissue: Callus, score: 46.945	N	N	N	N
vg0507602235	A -> C	LOC_Os05g13720-LOC_Os05g13730	intergenic_region ; MODIFIER	silent_mutation	Average:19.476; most accessible tissue: Callus, score: 46.945	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0507602235	NA	2.24E-26	mr1039	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507602235	NA	2.05E-06	mr1613	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507602235	3.09E-06	NA	mr1726	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507602235	NA	4.86E-12	mr1883	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507602235	NA	3.20E-30	mr1039_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507602235	NA	1.32E-14	mr1514_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507602235	NA	1.96E-32	mr1632_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251