Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0507595464:

Variant ID: vg0507595464 (JBrowse)	Variation Type: SNP
Chromosome: chr05	Position: 7595464
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.01, others allele: 0.00, population size: 222. )

Flanking Sequence (100 bp) in Reference Genome:

ACAAAAACTACGGAGATTTGCACCAGATTAAAAACAAGACATATGAGAAGAGCTCGACAAACTTCTCAAAGCTAGTTTCATCAGAGAGGTACTCCATCCA[G/A]
AGTGGCTAGCCAATCCAGTCATGGTGCGGAAGGCCAACGGGAAATGGAGAATGTGCGTCGATTTCACCGACCTCAACAAGGCGTGTCCCAAGGATCACTT

Reverse complement sequence

AAGTGATCCTTGGGACACGCCTTGTTGAGGTCGGTGAAATCGACGCACATTCTCCATTTCCCGTTGGCCTTCCGCACCATGACTGGATTGGCTAGCCACT[C/T]
TGGATGGAGTACCTCTCTGATGAAACTAGCTTTGAGAAGTTTGTCGAGCTCTTCTCATATGTCTTGTTTTTAATCTGGTGCAAATCTCCGTAGTTTTTGT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	72.30%	4.80%	13.61%	9.31%	NA
All Indica	2759	60.60%	1.90%	22.36%	15.11%	NA
All Japonica	1512	99.10%	0.10%	0.26%	0.60%	NA
Aus	269	30.90%	61.30%	5.58%	2.23%	NA
Indica I	595	46.90%	0.00%	34.29%	18.82%	NA
Indica II	465	62.60%	1.10%	19.78%	16.56%	NA
Indica III	913	69.20%	2.30%	15.01%	13.47%	NA
Indica Intermediate	786	59.90%	3.30%	23.41%	13.36%	NA
Temperate Japonica	767	98.70%	0.00%	0.39%	0.91%	NA
Tropical Japonica	504	99.40%	0.00%	0.20%	0.40%	NA
Japonica Intermediate	241	99.60%	0.40%	0.00%	0.00%	NA
VI/Aromatic	96	97.90%	2.10%	0.00%	0.00%	NA
Intermediate	90	76.70%	6.70%	7.78%	8.89%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0507595464	G -> DEL	N	N	silent_mutation	Average:7.495; most accessible tissue: Callus, score: 19.481	N	N	N	N
vg0507595464	G -> A	LOC_Os05g13710.1	upstream_gene_variant ; 21.0bp to feature; MODIFIER	silent_mutation	Average:7.495; most accessible tissue: Callus, score: 19.481	N	N	N	N
vg0507595464	G -> A	LOC_Os05g13720.1	upstream_gene_variant ; 3972.0bp to feature; MODIFIER	silent_mutation	Average:7.495; most accessible tissue: Callus, score: 19.481	N	N	N	N
vg0507595464	G -> A	LOC_Os05g13700.1	downstream_gene_variant ; 232.0bp to feature; MODIFIER	silent_mutation	Average:7.495; most accessible tissue: Callus, score: 19.481	N	N	N	N
vg0507595464	G -> A	LOC_Os05g13700-LOC_Os05g13710	intergenic_region ; MODIFIER	silent_mutation	Average:7.495; most accessible tissue: Callus, score: 19.481	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0507595464	7.63E-06	NA	mr1103	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507595464	3.12E-07	NA	mr1107	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507595464	5.54E-06	NA	mr1139	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507595464	NA	3.30E-16	mr1158	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507595464	NA	2.02E-06	mr1278	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251