Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0507301196:

Variant ID: vg0507301196 (JBrowse)	Variation Type: SNP
Chromosome: chr05	Position: 7301196
Reference Allele: C	Alternative Allele: G
Primary Allele: C	Secondary Allele: G

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 123. )

Flanking Sequence (100 bp) in Reference Genome:

CATGCGAGTTTTTTAAACATATTTCTTATATAATTTTCTCTGTATTACCAAAAGTGAACGATCTTAATAACCGACTCAAATATGGATATATAACCAAAAG[C/G]
AAACGAACTTAAAAACCGACTCATACACGGATGACGTACCAAAATACCGACAAAAACATCTTCAATTTTTATAACCGACTCAAACACGAATGATGGACCG

Reverse complement sequence

CGGTCCATCATTCGTGTTTGAGTCGGTTATAAAAATTGAAGATGTTTTTGTCGGTATTTTGGTACGTCATCCGTGTATGAGTCGGTTTTTAAGTTCGTTT[G/C]
CTTTTGGTTATATATCCATATTTGAGTCGGTTATTAAGATCGTTCACTTTTGGTAATACAGAGAAAATTATATAAGAAATATGTTTAAAAAACTCGCATG

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	94.40%	3.90%	1.76%	0.00%	NA
All Indica	2759	90.40%	6.60%	2.97%	0.00%	NA
All Japonica	1512	100.00%	0.00%	0.00%	0.00%	NA
Aus	269	99.60%	0.00%	0.37%	0.00%	NA
Indica I	595	92.60%	0.80%	6.55%	0.00%	NA
Indica II	465	92.30%	5.80%	1.94%	0.00%	NA
Indica III	913	92.30%	6.90%	0.77%	0.00%	NA
Indica Intermediate	786	85.50%	11.10%	3.44%	0.00%	NA
Temperate Japonica	767	100.00%	0.00%	0.00%	0.00%	NA
Tropical Japonica	504	100.00%	0.00%	0.00%	0.00%	NA
Japonica Intermediate	241	100.00%	0.00%	0.00%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	97.80%	2.20%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0507301196	C -> G	LOC_Os05g12710.1	upstream_gene_variant ; 2146.0bp to feature; MODIFIER	silent_mutation	Average:22.922; most accessible tissue: Callus, score: 41.802	N	N	N	N
vg0507301196	C -> G	LOC_Os05g12720.1	upstream_gene_variant ; 3325.0bp to feature; MODIFIER	silent_mutation	Average:22.922; most accessible tissue: Callus, score: 41.802	N	N	N	N
vg0507301196	C -> G	LOC_Os05g12730.1	downstream_gene_variant ; 4614.0bp to feature; MODIFIER	silent_mutation	Average:22.922; most accessible tissue: Callus, score: 41.802	N	N	N	N
vg0507301196	C -> G	LOC_Os05g12710-LOC_Os05g12720	intergenic_region ; MODIFIER	silent_mutation	Average:22.922; most accessible tissue: Callus, score: 41.802	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0507301196	NA	4.60E-06	mr1228	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507301196	NA	6.91E-07	mr1229	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507301196	NA	7.31E-06	mr1265	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507301196	4.78E-06	3.45E-07	mr1265	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507301196	1.42E-06	1.42E-06	mr1393	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507301196	8.95E-06	8.95E-06	mr1464	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507301196	NA	6.86E-07	mr1528	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507301196	3.40E-06	3.90E-06	mr1614	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507301196	NA	8.69E-07	mr1730	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507301196	1.07E-06	1.01E-06	mr1775	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507301196	1.88E-06	1.88E-06	mr1866	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251