Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0507287653:

Variant ID: vg0507287653 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 7287653
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, T: 0.00, others allele: 0.00, population size: 236. )

Flanking Sequence (100 bp) in Reference Genome:


TTACTGGCAGACTGGCTACATCAACGAAAAGCCATTGCTTAGGCTGTGTTCAGACCCAGGGTGAAAAGTTTTGGCGTGTCACATTAGATATACGGACACA[C/T]
ATTTAAAGTATTAAACATAGACTAATAACAAAACAAATTACAGATTTCGCCTGTAAACTACAAGACGAATTTATTAAGCCAAATTAATTTGTCATTAGCA

Reverse complement sequence

TGCTAATGACAAATTAATTTGGCTTAATAAATTCGTCTTGTAGTTTACAGGCGAAATCTGTAATTTGTTTTGTTATTAGTCTATGTTTAATACTTTAAAT[G/A]
TGTGTCCGTATATCTAATGTGACACGCCAAAACTTTTCACCCTGGGTCTGAACACAGCCTAAGCAATGGCTTTTCGTTGATGTAGCCAGTCTGCCAGTAA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 47.70% 46.90% 4.36% 1.02% NA
All Indica  2759 39.50% 52.50% 7.07% 0.87% NA
All Japonica  1512 54.40% 45.00% 0.20% 0.33% NA
Aus  269 80.70% 11.20% 1.49% 6.69% NA
Indica I  595 19.30% 57.50% 23.19% 0.00% NA
Indica II  465 23.20% 74.80% 1.29% 0.65% NA
Indica III  913 53.20% 44.10% 1.20% 1.42% NA
Indica Intermediate  786 48.60% 45.30% 5.09% 1.02% NA
Temperate Japonica  767 91.00% 9.00% 0.00% 0.00% NA
Tropical Japonica  504 9.10% 90.10% 0.20% 0.60% NA
Japonica Intermediate  241 32.80% 65.60% 0.83% 0.83% NA
VI/Aromatic  96 85.40% 14.60% 0.00% 0.00% NA
Intermediate  90 45.60% 48.90% 4.44% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0507287653 C -> T LOC_Os05g12680.1 upstream_gene_variant ; 2983.0bp to feature; MODIFIER silent_mutation Average:71.507; most accessible tissue: Minghui63 root, score: 86.705 N N N N
vg0507287653 C -> T LOC_Os05g12700.1 downstream_gene_variant ; 975.0bp to feature; MODIFIER silent_mutation Average:71.507; most accessible tissue: Minghui63 root, score: 86.705 N N N N
vg0507287653 C -> T LOC_Os05g12680-LOC_Os05g12700 intergenic_region ; MODIFIER silent_mutation Average:71.507; most accessible tissue: Minghui63 root, score: 86.705 N N N N
vg0507287653 C -> DEL N N silent_mutation Average:71.507; most accessible tissue: Minghui63 root, score: 86.705 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0507287653 C T -0.01 -0.03 -0.04 -0.02 -0.03 -0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0507287653 NA 2.15E-16 Grain_thickness Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0507287653 NA 6.92E-08 mr1403 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507287653 3.22E-11 3.12E-18 mr1593 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507287653 4.04E-06 1.22E-10 mr1593 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507287653 8.56E-11 3.92E-28 mr1593 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507287653 NA 1.88E-07 mr1916 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507287653 NA 6.90E-08 mr1133_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507287653 NA 9.82E-09 mr1364_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507287653 NA 1.77E-07 mr1582_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507287653 8.61E-11 2.46E-21 mr1593_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507287653 NA 5.66E-11 mr1593_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507287653 4.51E-13 3.00E-39 mr1593_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507287653 NA 2.52E-19 mr1807_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507287653 NA 1.80E-07 mr1807_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251