Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0507206367:

Variant ID: vg0507206367 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 7206367
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.94, T: 0.06, others allele: 0.00, population size: 103. )

Flanking Sequence (100 bp) in Reference Genome:


TCGCTCCTCCCGTTCACCCACCACCGCGCAATCTACGCCACGGCGGCACTGAAGTTGACGCCCGCCTCCTTAGGTTCGTCCTGCCACCGTCCGCCGTCAC[C/T]
GCCGCCATAGGCATCTAGTTCATGCCCCAAGCCATGCCGCACCAGTCCATCCCTCCCTCCTGACTGCGGTGGAGAGAGATCATAAAAAAAGTGAGGATAG

Reverse complement sequence

CTATCCTCACTTTTTTTATGATCTCTCTCCACCGCAGTCAGGAGGGAGGGATGGACTGGTGCGGCATGGCTTGGGGCATGAACTAGATGCCTATGGCGGC[G/A]
GTGACGGCGGACGGTGGCAGGACGAACCTAAGGAGGCGGGCGTCAACTTCAGTGCCGCCGTGGCGTAGATTGCGCGGTGGTGGGTGAACGGGAGGAGCGA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 58.40% 40.80% 0.13% 0.61% NA
All Indica  2759 38.60% 60.30% 0.22% 0.80% NA
All Japonica  1512 98.00% 1.70% 0.00% 0.33% NA
Aus  269 20.10% 79.90% 0.00% 0.00% NA
Indica I  595 18.00% 82.00% 0.00% 0.00% NA
Indica II  465 72.90% 26.20% 0.43% 0.43% NA
Indica III  913 36.90% 61.40% 0.22% 1.42% NA
Indica Intermediate  786 36.00% 62.80% 0.25% 0.89% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 96.20% 3.20% 0.00% 0.60% NA
Japonica Intermediate  241 95.40% 3.70% 0.00% 0.83% NA
VI/Aromatic  96 99.00% 1.00% 0.00% 0.00% NA
Intermediate  90 71.10% 26.70% 0.00% 2.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0507206367 C -> T LOC_Os05g12550.1 upstream_gene_variant ; 3658.0bp to feature; MODIFIER silent_mutation Average:70.771; most accessible tissue: Zhenshan97 young leaf, score: 87.004 N N N N
vg0507206367 C -> T LOC_Os05g12560.1 downstream_gene_variant ; 1283.0bp to feature; MODIFIER silent_mutation Average:70.771; most accessible tissue: Zhenshan97 young leaf, score: 87.004 N N N N
vg0507206367 C -> T LOC_Os05g12550-LOC_Os05g12560 intergenic_region ; MODIFIER silent_mutation Average:70.771; most accessible tissue: Zhenshan97 young leaf, score: 87.004 N N N N
vg0507206367 C -> DEL N N silent_mutation Average:70.771; most accessible tissue: Zhenshan97 young leaf, score: 87.004 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0507206367 C T -0.02 -0.01 -0.02 -0.01 -0.01 0.0

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0507206367 NA 3.39E-10 mr1050 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507206367 NA 4.29E-11 mr1195 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507206367 7.82E-07 1.75E-09 mr1195 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507206367 NA 2.01E-13 mr1272 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507206367 1.54E-08 NA mr1531 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507206367 3.39E-08 3.11E-12 mr1531 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507206367 3.82E-35 2.15E-29 mr1593 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507206367 1.18E-40 1.59E-70 mr1593 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507206367 NA 5.65E-12 mr1904 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507206367 1.67E-10 3.94E-32 mr1195_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507206367 3.19E-12 5.70E-23 mr1195_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507206367 NA 3.91E-09 mr1378_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507206367 NA 1.40E-09 mr1482_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507206367 NA 1.15E-07 mr1482_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507206367 1.17E-07 NA mr1531_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507206367 3.27E-09 3.22E-14 mr1531_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507206367 2.78E-44 1.06E-38 mr1593_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507206367 3.59E-49 1.33E-89 mr1593_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507206367 NA 2.19E-08 mr1748_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507206367 5.92E-06 NA mr1807_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507206367 2.91E-06 1.44E-10 mr1807_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251