Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0507173622:

Variant ID: vg0507173622 (JBrowse)	Variation Type: SNP
Chromosome: chr05	Position: 7173622
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 313. )

Flanking Sequence (100 bp) in Reference Genome:

GATGGAAGCTAATACATTCTTTAGCTCACCAAACCTACAACAAAGGGGACAAAATTCAGGTTTATAGGATGAGGCAAAATACACATGAGTTCACATTAAT[G/A]
GCTTGGAAATTCTGTAGAAGGGAACACCACATACTATTTTTTTTCAGGTTTGAATATTACCAACTTGGGAGCAAAAGTATCAAAGTAGAGACTTAGTTAA

Reverse complement sequence

TTAACTAAGTCTCTACTTTGATACTTTTGCTCCCAAGTTGGTAATATTCAAACCTGAAAAAAAATAGTATGTGGTGTTCCCTTCTACAGAATTTCCAAGC[C/T]
ATTAATGTGAACTCATGTGTATTTTGCCTCATCCTATAAACCTGAATTTTGTCCCCTTTGTTGTAGGTTTGGTGAGCTAAAGAATGTATTAGCTTCCATC

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	94.10%	4.00%	1.88%	0.00%	NA
All Indica	2759	90.10%	6.70%	3.12%	0.00%	NA
All Japonica	1512	99.90%	0.00%	0.13%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	93.60%	1.00%	5.38%	0.00%	NA
Indica II	465	92.90%	5.80%	1.29%	0.00%	NA
Indica III	913	92.20%	7.20%	0.55%	0.00%	NA
Indica Intermediate	786	83.50%	11.10%	5.47%	0.00%	NA
Temperate Japonica	767	99.90%	0.00%	0.13%	0.00%	NA
Tropical Japonica	504	100.00%	0.00%	0.00%	0.00%	NA
Japonica Intermediate	241	99.60%	0.00%	0.41%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	96.70%	2.20%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0507173622	G -> A	LOC_Os05g12481.1	upstream_gene_variant ; 4024.0bp to feature; MODIFIER	silent_mutation	Average:54.63; most accessible tissue: Zhenshan97 young leaf, score: 80.848	N	N	N	N
vg0507173622	G -> A	LOC_Os05g12490.1	intron_variant ; MODIFIER	silent_mutation	Average:54.63; most accessible tissue: Zhenshan97 young leaf, score: 80.848	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0507173622	NA	6.33E-06	mr1228	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507173622	NA	3.68E-07	mr1229	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507173622	NA	3.02E-06	mr1265	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507173622	4.79E-07	4.79E-07	mr1393	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507173622	NA	3.35E-06	mr1528	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507173622	7.93E-06	8.08E-06	mr1614	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507173622	NA	1.48E-06	mr1730	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507173622	1.82E-06	1.90E-06	mr1775	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507173622	4.62E-06	4.62E-06	mr1866	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251