Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0507120963:

Variant ID: vg0507120963 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 7120963
Reference Allele: GAlternative Allele: A
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GGCTGAATTCCAAGACTCGGATTCCTCGTCTCCCCTCTTTAACCTGAAACTAAGATGTGTTTCCTGCGACCCTTCTCAGAACCTGATTAGTTCCCACGCA[G/A]
AAACTTTTTATTCCGTCATATTAAATGTTTAGACACATGCATAGAGTATTAAATATAGAAAAAAACTAATCACGCTGATTGCGTGTAAATTGCGAGACGA

Reverse complement sequence

TCGTCTCGCAATTTACACGCAATCAGCGTGATTAGTTTTTTTCTATATTTAATACTCTATGCATGTGTCTAAACATTTAATATGACGGAATAAAAAGTTT[C/T]
TGCGTGGGAACTAATCAGGTTCTGAGAAGGGTCGCAGGAAACACATCTTAGTTTCAGGTTAAAGAGGGGAGACGAGGAATCCGAGTCTTGGAATTCAGCC

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 81.40% 18.60% 0.06% 0.00% NA
All Indica  2759 99.50% 0.40% 0.11% 0.00% NA
All Japonica  1512 43.90% 56.10% 0.00% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 99.50% 0.30% 0.17% 0.00% NA
Indica II  465 98.70% 1.30% 0.00% 0.00% NA
Indica III  913 99.80% 0.20% 0.00% 0.00% NA
Indica Intermediate  786 99.50% 0.30% 0.25% 0.00% NA
Temperate Japonica  767 9.30% 90.70% 0.00% 0.00% NA
Tropical Japonica  504 90.90% 9.10% 0.00% 0.00% NA
Japonica Intermediate  241 56.00% 44.00% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 81.10% 18.90% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0507120963 G -> A LOC_Os05g12380.1 upstream_gene_variant ; 2907.0bp to feature; MODIFIER silent_mutation Average:54.093; most accessible tissue: Callus, score: 70.192 N N N N
vg0507120963 G -> A LOC_Os05g12370-LOC_Os05g12380 intergenic_region ; MODIFIER silent_mutation Average:54.093; most accessible tissue: Callus, score: 70.192 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0507120963 NA 4.49E-43 Grain_thickness All YES Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0507120963 NA 7.10E-14 Grain_thickness Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0507120963 NA 1.86E-06 mr1401 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507120963 NA 6.25E-09 mr1549 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507120963 2.08E-07 1.67E-11 mr1593 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507120963 4.91E-10 6.50E-28 mr1593 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507120963 NA 4.34E-07 mr1723 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507120963 NA 2.91E-12 mr1741 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507120963 NA 1.92E-23 mr1862 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507120963 NA 1.07E-11 mr1879 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507120963 NA 8.95E-10 mr1093_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507120963 9.39E-09 3.18E-12 mr1593_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507120963 4.08E-15 4.77E-42 mr1593_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507120963 NA 1.35E-28 mr1789_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251