Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0507003092:

Variant ID: vg0507003092 (JBrowse)	Variation Type: SNP
Chromosome: chr05	Position: 7003092
Reference Allele: A	Alternative Allele: G
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.97, A: 0.04, others allele: 0.00, population size: 213. )

Flanking Sequence (100 bp) in Reference Genome:

TTCAAATATAACTTACAAACATAATATCATGCTTAAATATAAAAAAAATCACATTTTAATGAGAAAACAAAATTTATGGAAGTTCTAATTTGTCCAATTC[A/G]
TTTTTGGAGAAATATTTATTTTAGTTCCGTCGCTAGTTTAATAATGAGTAAATTGCATCAGCGGTACACGAATTGTTAGGTGGGTGCAATCTTGTACAAG

Reverse complement sequence

CTTGTACAAGATTGCACCCACCTAACAATTCGTGTACCGCTGATGCAATTTACTCATTATTAAACTAGCGACGGAACTAAAATAAATATTTCTCCAAAAA[T/C]
GAATTGGACAAATTAGAACTTCCATAAATTTTGTTTTCTCATTAAAATGTGATTTTTTTTATATTTAAGCATGATATTATGTTTGTAAGTTATATTTGAA

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	75.10%	24.60%	0.11%	0.23%	NA
All Indica	2759	76.70%	22.80%	0.14%	0.36%	NA
All Japonica	1512	83.10%	16.90%	0.00%	0.00%	NA
Aus	269	40.50%	59.50%	0.00%	0.00%	NA
Indica I	595	85.90%	13.90%	0.17%	0.00%	NA
Indica II	465	68.00%	31.80%	0.00%	0.22%	NA
Indica III	913	75.80%	23.80%	0.11%	0.33%	NA
Indica Intermediate	786	75.80%	23.20%	0.25%	0.76%	NA
Temperate Japonica	767	90.90%	9.10%	0.00%	0.00%	NA
Tropical Japonica	504	83.10%	16.90%	0.00%	0.00%	NA
Japonica Intermediate	241	58.10%	41.90%	0.00%	0.00%	NA
VI/Aromatic	96	1.00%	97.90%	1.04%	0.00%	NA
Intermediate	90	74.40%	24.40%	0.00%	1.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0507003092	A -> DEL	N	N	silent_mutation	Average:21.747; most accessible tissue: Zhenshan97 panicle, score: 36.038	N	N	N	N
vg0507003092	A -> G	LOC_Os05g12230.1	upstream_gene_variant ; 965.0bp to feature; MODIFIER	silent_mutation	Average:21.747; most accessible tissue: Zhenshan97 panicle, score: 36.038	N	N	N	N
vg0507003092	A -> G	LOC_Os05g12240.1	downstream_gene_variant ; 976.0bp to feature; MODIFIER	silent_mutation	Average:21.747; most accessible tissue: Zhenshan97 panicle, score: 36.038	N	N	N	N
vg0507003092	A -> G	LOC_Os05g12230-LOC_Os05g12240	intergenic_region ; MODIFIER	silent_mutation	Average:21.747; most accessible tissue: Zhenshan97 panicle, score: 36.038	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0507003092	4.84E-12	NA	mr1039	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507003092	6.64E-14	1.04E-23	mr1039	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507003092	NA	5.92E-09	mr1593	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507003092	NA	1.41E-06	mr1593	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507003092	NA	1.44E-08	mr1632	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507003092	9.92E-13	NA	mr1039_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507003092	3.23E-14	4.45E-24	mr1039_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507003092	NA	5.30E-06	mr1118_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507003092	NA	5.98E-06	mr1158_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507003092	NA	2.30E-08	mr1593_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507003092	1.12E-07	NA	mr1632_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507003092	2.04E-08	4.20E-14	mr1632_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251