Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0506970510:

Variant ID: vg0506970510 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 6970510
Reference Allele: CAlternative Allele: T
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.92, T: 0.08, others allele: 0.00, population size: 195. )

Flanking Sequence (100 bp) in Reference Genome:


AGGGACTTATGTTTTTGTGAGAGGGACTAAAGTTTAGCCCCACTTTAGTCCCTCCAACCAAACACCACCTAAGTCACCCATGGTCTCATGGACCTCTACA[C/T]
GTCAACAATATCGTCGGCACGCAGCAGGACAAATAAGCTGATTTCTATTGGTAGCTTTACATCGGACTCACTTTTTTGTTATAGGGATTTAATCTTACCT

Reverse complement sequence

AGGTAAGATTAAATCCCTATAACAAAAAAGTGAGTCCGATGTAAAGCTACCAATAGAAATCAGCTTATTTGTCCTGCTGCGTGCCGACGATATTGTTGAC[G/A]
TGTAGAGGTCCATGAGACCATGGGTGACTTAGGTGGTGTTTGGTTGGAGGGACTAAAGTGGGGCTAAACTTTAGTCCCTCTCACAAAAACATAAGTCCCT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 52.70% 47.20% 0.08% 0.02% NA
All Indica  2759 84.80% 15.00% 0.11% 0.04% NA
All Japonica  1512 3.40% 96.60% 0.00% 0.00% NA
Aus  269 23.00% 77.00% 0.00% 0.00% NA
Indica I  595 94.50% 5.50% 0.00% 0.00% NA
Indica II  465 80.20% 19.40% 0.43% 0.00% NA
Indica III  913 86.60% 13.30% 0.00% 0.11% NA
Indica Intermediate  786 78.10% 21.80% 0.13% 0.00% NA
Temperate Japonica  767 1.60% 98.40% 0.00% 0.00% NA
Tropical Japonica  504 3.20% 96.80% 0.00% 0.00% NA
Japonica Intermediate  241 10.00% 90.00% 0.00% 0.00% NA
VI/Aromatic  96 0.00% 100.00% 0.00% 0.00% NA
Intermediate  90 38.90% 60.00% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0506970510 C -> T LOC_Os05g12170-LOC_Os05g12180 intergenic_region ; MODIFIER silent_mutation Average:60.607; most accessible tissue: Minghui63 panicle, score: 81.412 N N N N
vg0506970510 C -> DEL N N silent_mutation Average:60.607; most accessible tissue: Minghui63 panicle, score: 81.412 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0506970510 8.41E-12 1.96E-35 mr1039 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506970510 1.42E-09 1.41E-09 mr1039 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506970510 NA 1.49E-11 mr1195 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506970510 NA 2.27E-14 mr1329 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506970510 NA 2.25E-10 mr1524 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506970510 5.19E-06 NA mr1593 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506970510 2.06E-06 1.11E-08 mr1593 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506970510 1.64E-11 7.16E-34 mr1632 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506970510 2.99E-09 1.62E-11 mr1632 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506970510 1.13E-08 NA mr1873 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506970510 1.50E-06 3.41E-09 mr1873 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506970510 4.13E-13 5.01E-40 mr1039_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506970510 1.08E-09 1.73E-10 mr1039_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506970510 3.72E-10 1.83E-22 mr1514_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506970510 3.91E-06 1.49E-06 mr1514_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506970510 NA 9.36E-19 mr1531_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506970510 3.55E-06 NA mr1593_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506970510 1.51E-06 2.52E-09 mr1593_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506970510 1.07E-16 5.61E-46 mr1632_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506970510 1.22E-12 1.68E-15 mr1632_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506970510 5.65E-08 3.81E-37 mr1873_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506970510 3.25E-07 5.41E-11 mr1873_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251