RiceVarMap2

Search for Variation information by Variation ID:

Detailed information for vg0506936871:

Variant ID: vg0506936871 (JBrowse)	Variation Type: SNP
Chromosome: chr05	Position: 6936871
Reference Allele: G	Alternative Allele: A
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.81, A: 0.19, others allele: 0.00, population size: 104. )

Flanking Sequence (100 bp) in Reference Genome:

TTTTTAAAATGAATATCGCTAATATGTCCACAGCCAAACAGTTCAACGTTAGAGGGAAATCTAATCTCAGCATTCCCCTTTATTGTGTACCGTAGAAAAC[G/A]
TCCAGAGATAATTTAGTAGATAAAGAGTTTTGATATGATTTATATTGCATATAACATCCTAGGAAATACAGACAAGCGGACATGTAAAACAATACAAGAT

Reverse complement sequence

ATCTTGTATTGTTTTACATGTCCGCTTGTCTGTATTTCCTAGGATGTTATATGCAATATAAATCATATCAAAACTCTTTATCTACTAAATTATCTCTGGA[C/T]
GTTTTCTACGGTACACAATAAAGGGGAATGCTGAGATTAGATTTCCCTCTAACGTTGAACTGTTTGGCTGTGGACATATTAGCGATATTCATTTTAAAAA

Allele Frequencies:

Search:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	58.00%	41.90%	0.04%	0.00%	NA
All Indica	2759	88.40%	11.50%	0.07%	0.00%	NA
All Japonica	1512	4.80%	95.20%	0.00%	0.00%	NA
Aus	269	71.00%	29.00%	0.00%	0.00%	NA
Indica I	595	95.80%	4.20%	0.00%	0.00%	NA
Indica II	465	80.00%	20.00%	0.00%	0.00%	NA
Indica III	913	89.00%	10.70%	0.22%	0.00%	NA
Indica Intermediate	786	87.00%	13.00%	0.00%	0.00%	NA
Temperate Japonica	767	1.60%	98.40%	0.00%	0.00%	NA
Tropical Japonica	504	5.60%	94.40%	0.00%	0.00%	NA
Japonica Intermediate	241	13.30%	86.70%	0.00%	0.00%	NA
VI/Aromatic	96	1.00%	99.00%	0.00%	0.00%	NA
Intermediate	90	44.40%	55.60%	0.00%	0.00%	NA

Showing 1 to 13 of 13 entries

Allele Effect:

Search:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0506936871	G -> A	LOC_Os05g12140.1	3_prime_UTR_variant ; 423.0bp to feature; MODIFIER	silent_mutation	Average:61.421; most accessible tissue: Callus, score: 80.654	N	N	N	N
vg0506936871	G -> A	LOC_Os05g12140.2	3_prime_UTR_variant ; 423.0bp to feature; MODIFIER	silent_mutation	Average:61.421; most accessible tissue: Callus, score: 80.654	N	N	N	N
vg0506936871	G -> A	LOC_Os05g12130.1	downstream_gene_variant ; 280.0bp to feature; MODIFIER	silent_mutation	Average:61.421; most accessible tissue: Callus, score: 80.654	N	N	N	N

Showing 1 to 3 of 3 entries

Putative Genotype-Phenotype Associations:

Show entries

Search:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0506936871	2.52E-11	9.22E-41	mr1039	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506936871	5.70E-08	5.13E-10	mr1039	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506936871	NA	2.55E-11	mr1514	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506936871	NA	2.72E-08	mr1593	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506936871	2.52E-09	1.66E-42	mr1632	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506936871	5.28E-07	5.72E-13	mr1632	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506936871	7.91E-10	3.76E-49	mr1873	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506936871	NA	3.75E-10	mr1873	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506936871	NA	1.66E-10	mr1904	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506936871	NA	4.28E-12	mr1940	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251

Showing 1 to 10 of 19 entries

Previous1 2Next

Search for Variation information by Variation ID:

Detailed information for vg0506936871:

Flanking Sequence (100 bp) in Reference Genome:

Reverse complement sequence

Allele Frequencies:

Allele Effect:

Putative Genotype-Phenotype Associations:

RiceVarMap v2.0

Tools

Blast

Design Primer by Variation ID

Design Primer by Region

Haplotype Network Analysis

Varitation Coordinate Convert

Contact