Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0506870350:

Variant ID: vg0506870350 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 6870350
Reference Allele: GAlternative Allele: A
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.80, A: 0.19, others allele: 0.00, population size: 108. )

Flanking Sequence (100 bp) in Reference Genome:


TCATTGCACACTTAGTATTTCCCTTTATTTTCGGTGCCTGATGATATATATGCTCATTAGATATCAACTAACCATTAGGTGCATTGTGCATGGATACCTC[G/A]
TGAGTAATATGACTTGGCGATCAATAAATAGTGACTTGTATATAAAACCTACATATAGGGGGATCAATGAGGACATATGATTGATATTTTAGGCTAGGAT

Reverse complement sequence

ATCCTAGCCTAAAATATCAATCATATGTCCTCATTGATCCCCCTATATGTAGGTTTTATATACAAGTCACTATTTATTGATCGCCAAGTCATATTACTCA[C/T]
GAGGTATCCATGCACAATGCACCTAATGGTTAGTTGATATCTAATGAGCATATATATCATCAGGCACCGAAAATAAAGGGAAATACTAAGTGTGCAATGA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 58.10% 41.90% 0.02% 0.00% NA
All Indica  2759 88.50% 11.40% 0.04% 0.00% NA
All Japonica  1512 4.70% 95.30% 0.00% 0.00% NA
Aus  269 71.00% 29.00% 0.00% 0.00% NA
Indica I  595 96.00% 4.00% 0.00% 0.00% NA
Indica II  465 80.20% 19.60% 0.22% 0.00% NA
Indica III  913 89.50% 10.50% 0.00% 0.00% NA
Indica Intermediate  786 86.80% 13.20% 0.00% 0.00% NA
Temperate Japonica  767 1.60% 98.40% 0.00% 0.00% NA
Tropical Japonica  504 5.60% 94.40% 0.00% 0.00% NA
Japonica Intermediate  241 12.90% 87.10% 0.00% 0.00% NA
VI/Aromatic  96 2.10% 97.90% 0.00% 0.00% NA
Intermediate  90 42.20% 57.80% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0506870350 G -> A LOC_Os05g12020.1 upstream_gene_variant ; 3477.0bp to feature; MODIFIER silent_mutation Average:34.278; most accessible tissue: Zhenshan97 young leaf, score: 55.899 N N N N
vg0506870350 G -> A LOC_Os05g12010.1 downstream_gene_variant ; 2109.0bp to feature; MODIFIER silent_mutation Average:34.278; most accessible tissue: Zhenshan97 young leaf, score: 55.899 N N N N
vg0506870350 G -> A LOC_Os05g12010-LOC_Os05g12020 intergenic_region ; MODIFIER silent_mutation Average:34.278; most accessible tissue: Zhenshan97 young leaf, score: 55.899 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0506870350 1.46E-13 3.95E-42 mr1039 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506870350 3.23E-09 2.19E-10 mr1039 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506870350 NA 4.69E-06 mr1039 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506870350 NA 4.49E-11 mr1514 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506870350 NA 4.66E-09 mr1593 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506870350 3.47E-10 5.41E-43 mr1632 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506870350 9.95E-08 4.55E-13 mr1632 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506870350 1.65E-09 2.31E-49 mr1873 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506870350 NA 2.00E-10 mr1873 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506870350 NA 2.05E-10 mr1904 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506870350 1.62E-16 2.18E-45 mr1039_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506870350 8.08E-10 1.28E-10 mr1039_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506870350 1.61E-08 1.77E-07 mr1039_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506870350 7.19E-13 7.07E-22 mr1514_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506870350 4.41E-07 4.65E-08 mr1514_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506870350 9.31E-07 9.31E-07 mr1514_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506870350 NA 4.74E-09 mr1593_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506870350 1.36E-20 9.81E-60 mr1632_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506870350 1.44E-12 2.39E-16 mr1632_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506870350 5.87E-08 2.83E-07 mr1632_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506870350 4.00E-10 1.52E-42 mr1873_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506870350 1.44E-06 1.43E-08 mr1873_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506870350 6.96E-06 NA mr1968_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251