Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0506747780:

Variant ID: vg0506747780 (JBrowse)	Variation Type: SNP
Chromosome: chr05	Position: 6747780
Reference Allele: G	Alternative Allele: A
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.72, A: 0.29, others allele: 0.00, population size: 200. )

Flanking Sequence (100 bp) in Reference Genome:

ATGAGGGCGTCAGTTTCGGTCTTCCAACACCTCTATGTGCTTTTCTCGCCATATGAGGCTTGCTCATTCACGTCTTACTCTTTCATTCGCGGATAGTGGG[G/A]
AACCGATCTGGTAGTGTCTCTCATCTTGTCTCACAGCAACAGTGGACGTGTTCGTCCGACGGCTAGCGTGTTCATCCGATGCATGCTAGGTGTTTCCCGC

Reverse complement sequence

GCGGGAAACACCTAGCATGCATCGGATGAACACGCTAGCCGTCGGACGAACACGTCCACTGTTGCTGTGAGACAAGATGAGAGACACTACCAGATCGGTT[C/T]
CCCACTATCCGCGAATGAAAGAGTAAGACGTGAATGAGCAAGCCTCATATGGCGAGAAAAGCACATAGAGGTGTTGGAAGACCGAAACTGACGCCCTCAT

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	49.50%	49.20%	0.99%	0.32%	NA
All Indica	2759	75.20%	23.20%	1.05%	0.54%	NA
All Japonica	1512	2.40%	97.60%	0.00%	0.00%	NA
Aus	269	76.60%	18.20%	5.20%	0.00%	NA
Indica I	595	78.20%	20.20%	0.84%	0.84%	NA
Indica II	465	73.80%	25.40%	0.43%	0.43%	NA
Indica III	913	74.20%	24.80%	0.66%	0.44%	NA
Indica Intermediate	786	74.90%	22.50%	2.04%	0.51%	NA
Temperate Japonica	767	1.30%	98.70%	0.00%	0.00%	NA
Tropical Japonica	504	3.40%	96.60%	0.00%	0.00%	NA
Japonica Intermediate	241	4.10%	95.90%	0.00%	0.00%	NA
VI/Aromatic	96	1.00%	99.00%	0.00%	0.00%	NA
Intermediate	90	22.20%	73.30%	4.44%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0506747780	G -> DEL	N	N	silent_mutation	Average:55.103; most accessible tissue: Callus, score: 79.2	N	N	N	N
vg0506747780	G -> A	LOC_Os05g11840.1	upstream_gene_variant ; 3018.0bp to feature; MODIFIER	silent_mutation	Average:55.103; most accessible tissue: Callus, score: 79.2	N	N	N	N
vg0506747780	G -> A	LOC_Os05g11850.1	downstream_gene_variant ; 4442.0bp to feature; MODIFIER	silent_mutation	Average:55.103; most accessible tissue: Callus, score: 79.2	N	N	N	N
vg0506747780	G -> A	LOC_Os05g11820-LOC_Os05g11840	intergenic_region ; MODIFIER	silent_mutation	Average:55.103; most accessible tissue: Callus, score: 79.2	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0506747780	6.66E-06	2.30E-06	mr1185	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506747780	2.58E-06	1.08E-06	mr1269	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506747780	NA	5.93E-26	mr1632	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506747780	3.84E-06	3.69E-08	mr1677	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506747780	4.76E-06	NA	mr1678	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506747780	4.40E-06	3.57E-08	mr1678	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506747780	NA	2.58E-09	mr1722	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506747780	NA	6.95E-32	mr1632_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251