Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0506420059:

Variant ID: vg0506420059 (JBrowse)	Variation Type: SNP
Chromosome: chr05	Position: 6420059
Reference Allele: A	Alternative Allele: G
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, others allele: 0.00, population size: 363. )

Flanking Sequence (100 bp) in Reference Genome:

ACCTATTTATTATTATTTGTCATGTGATGCTCAGATGGATTTAGATCATACTCATGAATACATTATCCAACAACAAGCTAGAACTTTGGCCATTTTAGCT[A/G]
CCGTGTTGGCTATTATTCGTTGGCGACGTCGTAAGAAAAATAGACGGATTCCAAGGAAATATGGGCCTTTGGTGGATAGAGATCTGATCAGACAAACAAG

Reverse complement sequence

CTTGTTTGTCTGATCAGATCTCTATCCACCAAAGGCCCATATTTCCTTGGAATCCGTCTATTTTTCTTACGACGTCGCCAACGAATAATAGCCAACACGG[T/C]
AGCTAAAATGGCCAAAGTTCTAGCTTGTTGTTGGATAATGTATTCATGAGTATGATCTAAATCCATCTGAGCATCACATGACAAATAATAATAAATAGGT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	86.10%	9.00%	4.85%	0.00%	NA
All Indica	2759	95.10%	1.50%	3.37%	0.00%	NA
All Japonica	1512	66.20%	24.90%	8.86%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	93.10%	1.70%	5.21%	0.00%	NA
Indica II	465	92.70%	2.40%	4.95%	0.00%	NA
Indica III	913	99.60%	0.20%	0.22%	0.00%	NA
Indica Intermediate	786	93.00%	2.30%	4.71%	0.00%	NA
Temperate Japonica	767	39.50%	44.50%	16.04%	0.00%	NA
Tropical Japonica	504	97.00%	2.60%	0.40%	0.00%	NA
Japonica Intermediate	241	86.70%	9.50%	3.73%	0.00%	NA
VI/Aromatic	96	97.90%	1.00%	1.04%	0.00%	NA
Intermediate	90	91.10%	7.80%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0506420059	A -> G	LOC_Os05g11360.1	upstream_gene_variant ; 2930.0bp to feature; MODIFIER	silent_mutation	Average:47.497; most accessible tissue: Zhenshan97 young leaf, score: 72.747	N	N	N	N
vg0506420059	A -> G	LOC_Os05g11350.1	downstream_gene_variant ; 3696.0bp to feature; MODIFIER	silent_mutation	Average:47.497; most accessible tissue: Zhenshan97 young leaf, score: 72.747	N	N	N	N
vg0506420059	A -> G	LOC_Os05g11370.1	intron_variant ; MODIFIER	silent_mutation	Average:47.497; most accessible tissue: Zhenshan97 young leaf, score: 72.747	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0506420059	NA	9.14E-06	mr1164	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506420059	1.40E-06	NA	mr1238	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506420059	2.32E-06	NA	mr1309	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506420059	6.73E-06	NA	mr1309	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506420059	1.84E-07	NA	mr1841	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506420059	4.67E-06	NA	mr1841	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506420059	2.07E-06	NA	mr1900	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506420059	1.97E-06	NA	mr1926	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506420059	NA	3.38E-06	mr1011_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506420059	7.47E-06	NA	mr1841_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506420059	2.45E-06	NA	mr1900_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251