Variant ID: vg0506100456 (JBrowse) | Variation Type: SNP |
Chromosome: chr05 | Position: 6100456 |
Reference Allele: G | Alternative Allele: A |
Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 304. )
CATGATGTTCAGGCCAAACTCTTGTATAGGCATTTGCTTGATCAGATACCTACCCCAGTAGGACTCATGCAAAGATACCTTCTGTGAGTGCAGTTTATAG[G/A]
ATTGAGAGGTATTGGGATCTTAGCCTCAACAAATCAACCCTCCACGAGTGCTTGGGAATTCAAAGTAAATTAAAAGAGAGTTAAAATGGAGTTGCAAAAC
GTTTTGCAACTCCATTTTAACTCTCTTTTAATTTACTTTGAATTCCCAAGCACTCGTGGAGGGTTGATTTGTTGAGGCTAAGATCCCAATACCTCTCAAT[C/T]
CTATAAACTGCACTCACAGAAGGTATCTTTGCATGAGTCCTACTGGGGTAGGTATCTGATCAAGCAAATGCCTATACAAGAGTTTGGCCTGAACATCATG
Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
---|---|---|---|---|---|---|
All | 4726 | 88.50% | 10.70% | 0.80% | 0.00% | NA |
All Indica | 2759 | 80.80% | 18.00% | 1.23% | 0.00% | NA |
All Japonica | 1512 | 99.50% | 0.20% | 0.26% | 0.00% | NA |
Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Indica I | 595 | 83.00% | 14.50% | 2.52% | 0.00% | NA |
Indica II | 465 | 69.20% | 29.20% | 1.51% | 0.00% | NA |
Indica III | 913 | 85.90% | 14.10% | 0.00% | 0.00% | NA |
Indica Intermediate | 786 | 80.00% | 18.40% | 1.53% | 0.00% | NA |
Temperate Japonica | 767 | 99.50% | 0.10% | 0.39% | 0.00% | NA |
Tropical Japonica | 504 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
Japonica Intermediate | 241 | 99.60% | 0.00% | 0.41% | 0.00% | NA |
VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Intermediate | 90 | 92.20% | 7.80% | 0.00% | 0.00% | NA |
Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
---|---|---|---|---|---|---|---|---|---|
vg0506100456 | G -> A | LOC_Os05g10940-LOC_Os05g10950 | intergenic_region ; MODIFIER | silent_mutation | Average:45.398; most accessible tissue: Minghui63 flower, score: 56.663 | N | N | N | N |
Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
---|---|---|---|---|---|---|
vg0506100456 | 1.36E-06 | 5.87E-28 | mr1039 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0506100456 | NA | 2.26E-13 | mr1039 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0506100456 | 2.14E-09 | 2.25E-28 | mr1039_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0506100456 | 7.75E-07 | 8.46E-13 | mr1039_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0506100456 | 3.08E-08 | NA | mr1632_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0506100456 | 2.53E-06 | 9.05E-10 | mr1632_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |