Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0505634624:

Variant ID: vg0505634624 (JBrowse)	Variation Type: SNP
Chromosome: chr05	Position: 5634624
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.88, G: 0.12, others allele: 0.00, population size: 186. )

Flanking Sequence (100 bp) in Reference Genome:

TCCATCGTCATCTTCATAATAGTATGACCTGCACTCAAATCCAGATTCTAGCTCGAATTATTAAATAACCCTGCTAGCTATCATCCGTAGTAATCTGGCC[G/A]
ATCACATTCATCACATGGCCAAATTACACAATAAACATACACCACTTGCAAGGGGGATTTAATCAAAATATTTTCAAAGAGCCAATAATTCCGCGAGCTA

Reverse complement sequence

TAGCTCGCGGAATTATTGGCTCTTTGAAAATATTTTGATTAAATCCCCCTTGCAAGTGGTGTATGTTTATTGTGTAATTTGGCCATGTGATGAATGTGAT[C/T]
GGCCAGATTACTACGGATGATAGCTAGCAGGGTTATTTAATAATTCGAGCTAGAATCTGGATTTGAGTGCAGGTCATACTATTATGAAGATGACGATGGA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	31.60%	5.10%	1.04%	62.25%	NA
All Indica	2759	17.30%	4.50%	0.98%	77.20%	NA
All Japonica	1512	58.60%	0.30%	0.40%	40.74%	NA
Aus	269	8.60%	34.90%	5.20%	51.30%	NA
Indica I	595	29.60%	0.20%	0.84%	69.41%	NA
Indica II	465	12.30%	1.50%	0.86%	85.38%	NA
Indica III	913	9.70%	6.60%	0.99%	82.69%	NA
Indica Intermediate	786	19.70%	7.30%	1.15%	71.88%	NA
Temperate Japonica	767	92.60%	0.00%	0.00%	7.43%	NA
Tropical Japonica	504	10.90%	0.60%	0.99%	87.50%	NA
Japonica Intermediate	241	50.20%	0.40%	0.41%	48.96%	NA
VI/Aromatic	96	79.20%	8.30%	0.00%	12.50%	NA
Intermediate	90	34.40%	12.20%	2.22%	51.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0505634624	G -> DEL	N	N	silent_mutation	Average:15.274; most accessible tissue: Callus, score: 87.084	N	N	N	N
vg0505634624	G -> A	LOC_Os05g10310.1	upstream_gene_variant ; 1718.0bp to feature; MODIFIER	silent_mutation	Average:15.274; most accessible tissue: Callus, score: 87.084	N	N	N	N
vg0505634624	G -> A	LOC_Os05g10320.1	upstream_gene_variant ; 1240.0bp to feature; MODIFIER	silent_mutation	Average:15.274; most accessible tissue: Callus, score: 87.084	N	N	N	N
vg0505634624	G -> A	LOC_Os05g10310.3	upstream_gene_variant ; 1718.0bp to feature; MODIFIER	silent_mutation	Average:15.274; most accessible tissue: Callus, score: 87.084	N	N	N	N
vg0505634624	G -> A	LOC_Os05g10310.2	upstream_gene_variant ; 1718.0bp to feature; MODIFIER	silent_mutation	Average:15.274; most accessible tissue: Callus, score: 87.084	N	N	N	N
vg0505634624	G -> A	LOC_Os05g10330.1	downstream_gene_variant ; 3898.0bp to feature; MODIFIER	silent_mutation	Average:15.274; most accessible tissue: Callus, score: 87.084	N	N	N	N
vg0505634624	G -> A	LOC_Os05g10310-LOC_Os05g10320	intergenic_region ; MODIFIER	silent_mutation	Average:15.274; most accessible tissue: Callus, score: 87.084	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0505634624	NA	1.34E-06	mr1265	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0505634624	3.71E-07	1.43E-07	mr1528	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0505634624	NA	4.50E-06	mr1528	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0505634624	5.31E-06	NA	mr1652	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0505634624	3.75E-12	6.87E-10	mr1697	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0505634624	2.45E-11	2.12E-12	mr1697	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251