Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0505632591:

Variant ID: vg0505632591 (JBrowse)	Variation Type: SNP
Chromosome: chr05	Position: 5632591
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.01, others allele: 0.00, population size: 90. )

Flanking Sequence (100 bp) in Reference Genome:

GGGTCTCGGCGTAGGCGACGGCCTCGTCGACGACGACGGCGAAGTCGCGGCGGTAGTGTTCGCCTAGCATGTAGTGGCCGATGTAGCCCTCGCACTCGGC[T/C]
GGCACCGTCCTCCAGTCGATCACGTTGTGCGCCTCCACGCCCAGCCTCCAGCTGTCGCAGGCCACGCCGGCGCGCGCCGCCAGCTGCCGGCCGGAGCCCA

Reverse complement sequence

TGGGCTCCGGCCGGCAGCTGGCGGCGCGCGCCGGCGTGGCCTGCGACAGCTGGAGGCTGGGCGTGGAGGCGCACAACGTGATCGACTGGAGGACGGTGCC[A/G]
GCCGAGTGCGAGGGCTACATCGGCCACTACATGCTAGGCGAACACTACCGCCGCGACTTCGCCGTCGTCGTCGACGAGGCCGTCGCCTACGCCGAGACCC

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	30.70%	7.00%	3.55%	58.80%	NA
All Indica	2759	15.90%	8.60%	5.36%	70.10%	NA
All Japonica	1512	58.30%	0.40%	0.26%	41.01%	NA
Aus	269	8.20%	24.20%	4.46%	63.20%	NA
Indica I	595	27.60%	4.70%	9.75%	57.98%	NA
Indica II	465	11.40%	3.00%	4.09%	81.51%	NA
Indica III	913	9.00%	13.40%	3.40%	74.26%	NA
Indica Intermediate	786	17.80%	9.40%	5.09%	67.68%	NA
Temperate Japonica	767	92.70%	0.30%	0.13%	6.91%	NA
Tropical Japonica	504	10.30%	0.60%	0.40%	88.69%	NA
Japonica Intermediate	241	49.40%	0.40%	0.41%	49.79%	NA
VI/Aromatic	96	79.20%	7.30%	0.00%	13.54%	NA
Intermediate	90	33.30%	15.60%	4.44%	46.67%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0505632591	T -> DEL	LOC_Os05g10310.2	N	frameshift_variant	Average:17.977; most accessible tissue: Callus, score: 52.242	N	N	N	N
vg0505632591	T -> DEL	LOC_Os05g10310.1	N	frameshift_variant	Average:17.977; most accessible tissue: Callus, score: 52.242	N	N	N	N
vg0505632591	T -> DEL	LOC_Os05g10310.3	N	frameshift_variant	Average:17.977; most accessible tissue: Callus, score: 52.242	N	N	N	N
vg0505632591	T -> C	LOC_Os05g10310.1	synonymous_variant ; p.Pro88Pro; LOW	synonymous_codon	Average:17.977; most accessible tissue: Callus, score: 52.242	N	N	N	N
vg0505632591	T -> C	LOC_Os05g10310.3	synonymous_variant ; p.Pro88Pro; LOW	synonymous_codon	Average:17.977; most accessible tissue: Callus, score: 52.242	N	N	N	N
vg0505632591	T -> C	LOC_Os05g10310.2	synonymous_variant ; p.Pro88Pro; LOW	synonymous_codon	Average:17.977; most accessible tissue: Callus, score: 52.242	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0505632591	1.33E-06	NA	mr1245	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0505632591	2.72E-07	1.18E-06	mr1245	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0505632591	3.20E-06	NA	mr1373	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0505632591	3.62E-07	3.62E-07	mr1373	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0505632591	1.57E-12	1.47E-09	mr1697	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0505632591	1.56E-12	1.39E-12	mr1697	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251