RiceVarMap2

Search for Variation information by Variation ID:

Detailed information for vg0505613072:

Variant ID: vg0505613072 (JBrowse)	Variation Type: SNP
Chromosome: chr05	Position: 5613072
Reference Allele: G	Alternative Allele: T
Primary Allele: G	Secondary Allele: T

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 263. )

Flanking Sequence (100 bp) in Reference Genome:

TGCATTTGAACGTGTGCCTTGTCACAACATCGGTTTTTCTGCTATGGTAATTGCTAGCTTTGCATGTAGAGAAACCAACCATATAAGCATAACCATTGTA[G/T]
AAGTCAAAAGCTTCATTCTCATCAGCAAAAACTTTGTTGATTGACGGCGCATGTGCACTGTTAGCTTCCTGACCACCTCTCTGAACAGCTGCTACACTTT

Reverse complement sequence

AAAGTGTAGCAGCTGTTCAGAGAGGTGGTCAGGAAGCTAACAGTGCACATGCGCCGTCAATCAACAAAGTTTTTGCTGATGAGAATGAAGCTTTTGACTT[C/A]
TACAATGGTTATGCTTATATGGTTGGTTTCTCTACATGCAAAGCTAGCAATTACCATAGCAGAAAAACCGATGTTGTGACAAGGCACACGTTCAAATGCA

Allele Frequencies:

Search:

Populations	Population Size	Frequency of G(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	96.70%	2.20%	1.08%	0.00%	NA
All Indica	2759	94.50%	3.70%	1.81%	0.00%	NA
All Japonica	1512	99.80%	0.20%	0.00%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	98.70%	0.00%	1.34%	0.00%	NA
Indica II	465	75.90%	18.30%	5.81%	0.00%	NA
Indica III	913	99.50%	0.00%	0.55%	0.00%	NA
Indica Intermediate	786	96.40%	2.30%	1.27%	0.00%	NA
Temperate Japonica	767	99.90%	0.10%	0.00%	0.00%	NA
Tropical Japonica	504	99.60%	0.40%	0.00%	0.00%	NA
Japonica Intermediate	241	100.00%	0.00%	0.00%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	98.90%	0.00%	1.11%	0.00%	NA

Showing 1 to 13 of 13 entries

Allele Effect:

Search:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0505613072	G -> T	LOC_Os05g10270.1	downstream_gene_variant ; 3438.0bp to feature; MODIFIER	silent_mutation	Average:17.38; most accessible tissue: Minghui63 flag leaf, score: 23.047	N	N	N	N
vg0505613072	G -> T	LOC_Os05g10270-LOC_Os05g10290	intergenic_region ; MODIFIER	silent_mutation	Average:17.38; most accessible tissue: Minghui63 flag leaf, score: 23.047	N	N	N	N

Showing 1 to 2 of 2 entries

Putative Genotype-Phenotype Associations:

Show entries

Search:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0505613072	NA	1.42E-10	mr1039	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0505613072	9.40E-15	NA	mr1039_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0505613072	2.77E-10	5.49E-12	mr1039_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0505613072	NA	3.28E-06	mr1042_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0505613072	NA	3.32E-06	mr1133_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0505613072	2.46E-08	NA	mr1632_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0505613072	8.72E-06	9.64E-10	mr1632_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0505613072	NA	1.79E-06	mr1726_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251

Showing 1 to 8 of 8 entries

Previous1Next

Search for Variation information by Variation ID:

Detailed information for vg0505613072:

Flanking Sequence (100 bp) in Reference Genome:

Reverse complement sequence

Allele Frequencies:

Allele Effect:

Putative Genotype-Phenotype Associations:

RiceVarMap v2.0

Tools

Blast

Design Primer by Variation ID

Design Primer by Region

Haplotype Network Analysis

Varitation Coordinate Convert

Contact