Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0505543319:

Variant ID: vg0505543319 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 5543319
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TGGTAACTACTGTGCATGTAACTAGCGAAAGATTTTGCATGTACTCCCTCCGTTTCAAAATGTTTGACGCCGTTGACTTTTTAGCACATGTTTGACCGTT[C/T]
GTCTTATTAAAAAAAATTAAGTAATTATTAATCATTTTCCTATCATTTGATTCATTGTTAAATATATTTTTATGTAGGCATATAATTTTACATATTTCAC

Reverse complement sequence

GTGAAATATGTAAAATTATATGCCTACATAAAAATATATTTAACAATGAATCAAATGATAGGAAAATGATTAATAATTACTTAATTTTTTTTAATAAGAC[G/A]
AACGGTCAAACATGTGCTAAAAAGTCAACGGCGTCAAACATTTTGAAACGGAGGGAGTACATGCAAAATCTTTCGCTAGTTACATGCACAGTAGTTACCA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 93.80% 6.20% 0.00% 0.00% NA
All Indica  2759 98.20% 1.80% 0.00% 0.00% NA
All Japonica  1512 99.90% 0.10% 0.00% 0.00% NA
Aus  269 15.60% 84.40% 0.00% 0.00% NA
Indica I  595 99.30% 0.70% 0.00% 0.00% NA
Indica II  465 98.10% 1.90% 0.00% 0.00% NA
Indica III  913 98.50% 1.50% 0.00% 0.00% NA
Indica Intermediate  786 97.10% 2.90% 0.00% 0.00% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 99.20% 0.80% 0.00% 0.00% NA
VI/Aromatic  96 93.80% 6.20% 0.00% 0.00% NA
Intermediate  90 93.30% 6.70% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0505543319 C -> T LOC_Os05g09740-LOC_Os05g10210 intergenic_region ; MODIFIER silent_mutation Average:46.671; most accessible tissue: Callus, score: 68.559 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0505543319 2.65E-06 2.64E-25 mr1244 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0505543319 NA 2.27E-07 mr1328 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0505543319 NA 6.20E-09 mr1348 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0505543319 NA 1.35E-21 mr1589 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0505543319 NA 4.55E-11 mr1612 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0505543319 NA 4.62E-28 mr1858 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0505543319 NA 4.26E-28 mr1859 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0505543319 NA 3.00E-12 mr1918 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251