Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0505178248:

Variant ID: vg0505178248 (JBrowse)	Variation Type: SNP
Chromosome: chr05	Position: 5178248
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.99, others allele: 0.00, population size: 126. )

Flanking Sequence (100 bp) in Reference Genome:

GTTTAAAGATGTCATTTTTTTTTTATTTCATATTTTGTAGTAGTGTCCCGTTACAGGTCAGGTTTCTATATAAATTAATCATCTTCACCTACAGTGTACG[T/C]
GTACGATATTGTTACGTCATCTTTTCTAGAATATAGTAGCTATTTATAACATTAAAGTTACTCGTAAAACTCATAAGATACCATCACTTCTCGACTTCAT

Reverse complement sequence

ATGAAGTCGAGAAGTGATGGTATCTTATGAGTTTTACGAGTAACTTTAATGTTATAAATAGCTACTATATTCTAGAAAAGATGACGTAACAATATCGTAC[A/G]
CGTACACTGTAGGTGAAGATGATTAATTTATATAGAAACCTGACCTGTAACGGGACACTACTACAAAATATGAAATAAAAAAAAAATGACATCTTTAAAC

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	91.50%	3.00%	1.21%	4.34%	NA
All Indica	2759	92.90%	5.00%	1.52%	0.65%	NA
All Japonica	1512	99.70%	0.20%	0.00%	0.07%	NA
Aus	269	28.60%	0.40%	5.20%	65.80%	NA
Indica I	595	99.70%	0.00%	0.34%	0.00%	NA
Indica II	465	69.00%	23.00%	7.10%	0.86%	NA
Indica III	913	99.90%	0.00%	0.00%	0.11%	NA
Indica Intermediate	786	93.60%	3.80%	0.89%	1.65%	NA
Temperate Japonica	767	99.90%	0.10%	0.00%	0.00%	NA
Tropical Japonica	504	99.60%	0.40%	0.00%	0.00%	NA
Japonica Intermediate	241	99.60%	0.00%	0.00%	0.41%	NA
VI/Aromatic	96	96.90%	0.00%	0.00%	3.12%	NA
Intermediate	90	91.10%	1.10%	1.11%	6.67%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0505178248	T -> DEL	N	N	silent_mutation	Average:45.439; most accessible tissue: Callus, score: 61.578	N	N	N	N
vg0505178248	T -> C	LOC_Os05g09260.1	downstream_gene_variant ; 4094.0bp to feature; MODIFIER	silent_mutation	Average:45.439; most accessible tissue: Callus, score: 61.578	N	N	N	N
vg0505178248	T -> C	LOC_Os05g09270.1	downstream_gene_variant ; 2634.0bp to feature; MODIFIER	silent_mutation	Average:45.439; most accessible tissue: Callus, score: 61.578	N	N	N	N
vg0505178248	T -> C	LOC_Os05g09270-LOC_Os05g09280	intergenic_region ; MODIFIER	silent_mutation	Average:45.439; most accessible tissue: Callus, score: 61.578	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0505178248	7.64E-07	7.63E-07	mr1197	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0505178248	NA	2.90E-06	mr1050_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0505178248	NA	3.44E-08	mr1933_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251