Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0504587625:

Variant ID: vg0504587625 (JBrowse)	Variation Type: SNP
Chromosome: chr05	Position: 4587625
Reference Allele: A	Alternative Allele: C
Primary Allele: A	Secondary Allele: C

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.98, C: 0.01, others allele: 0.00, population size: 122. )

Flanking Sequence (100 bp) in Reference Genome:

GAACTCACACTTGTCGATGGCATTTCTGGGATTTGGACGCTTATCAATGGCATTTCTTGGATTATCTCATTGTGAGATGTTAACTACAGGTTGATCTTAA[A/C]
TTTGCTAAGAGAAAATATGCATTTAACAAACCCAACCAAGTGTTGCTCTTTTCTTTTTAAAATCTAGAGGCTGCTCTAACAGCAGCTGTGCAATATTCAA

Reverse complement sequence

TTGAATATTGCACAGCTGCTGTTAGAGCAGCCTCTAGATTTTAAAAAGAAAAGAGCAACACTTGGTTGGGTTTGTTAAATGCATATTTTCTCTTAGCAAA[T/G]
TTAAGATCAACCTGTAGTTAACATCTCACAATGAGATAATCCAAGAAATGCCATTGATAAGCGTCCAAATCCCAGAAATGCCATCGACAAGTGTGAGTTC

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	78.80%	16.80%	4.38%	0.00%	NA
All Indica	2759	64.40%	28.40%	7.18%	0.00%	NA
All Japonica	1512	99.70%	0.30%	0.07%	0.00%	NA
Aus	269	98.50%	0.00%	1.49%	0.00%	NA
Indica I	595	82.70%	5.70%	11.60%	0.00%	NA
Indica II	465	37.00%	52.30%	10.75%	0.00%	NA
Indica III	913	65.50%	32.90%	1.64%	0.00%	NA
Indica Intermediate	786	65.50%	26.30%	8.14%	0.00%	NA
Temperate Japonica	767	99.70%	0.30%	0.00%	0.00%	NA
Tropical Japonica	504	99.40%	0.40%	0.20%	0.00%	NA
Japonica Intermediate	241	100.00%	0.00%	0.00%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	86.70%	8.90%	4.44%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0504587625	A -> C	LOC_Os05g08400.1	upstream_gene_variant ; 3587.0bp to feature; MODIFIER	silent_mutation	Average:35.346; most accessible tissue: Minghui63 panicle, score: 46.754	N	N	N	N
vg0504587625	A -> C	LOC_Os05g08414.1	upstream_gene_variant ; 1523.0bp to feature; MODIFIER	silent_mutation	Average:35.346; most accessible tissue: Minghui63 panicle, score: 46.754	N	N	N	N
vg0504587625	A -> C	LOC_Os05g08414.2	upstream_gene_variant ; 1523.0bp to feature; MODIFIER	silent_mutation	Average:35.346; most accessible tissue: Minghui63 panicle, score: 46.754	N	N	N	N
vg0504587625	A -> C	LOC_Os05g08410.1	intron_variant ; MODIFIER	silent_mutation	Average:35.346; most accessible tissue: Minghui63 panicle, score: 46.754	N	N	N	N
vg0504587625	A -> C	LOC_Os05g08410.2	intron_variant ; MODIFIER	silent_mutation	Average:35.346; most accessible tissue: Minghui63 panicle, score: 46.754	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0504587625	NA	3.25E-14	Grain_length	All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0504587625	NA	2.99E-14	Grain_length	Ind_All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0504587625	3.10E-06	1.21E-17	Grain_width	Ind_All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0504587625	NA	9.78E-06	mr1063	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504587625	NA	9.10E-13	mr1183	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504587625	NA	1.31E-12	mr1503	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504587625	1.54E-06	1.54E-06	mr1562	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251