Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0504159174:

Variant ID: vg0504159174 (JBrowse)	Variation Type: SNP
Chromosome: chr05	Position: 4159174
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TTAAGAAAGTAGGTATAGATAATTAAAGAAGGGTTATGATTGGTGGAGAAGAGAATGGTTGCGATTGGTTGAGATAAGAGGGCAGGTGAAAAAATAGCTT[C/T]
ATTTTGGTACAAATCACATTTTAGAACGGATGTAGTAAGTAGTAGCTTAAAATTACTGGATTAATATAATTTTATAAAGTAACTTTCATATTGAATTTTT

Reverse complement sequence

AAAAATTCAATATGAAAGTTACTTTATAAAATTATATTAATCCAGTAATTTTAAGCTACTACTTACTACATCCGTTCTAAAATGTGATTTGTACCAAAAT[G/A]
AAGCTATTTTTTCACCTGCCCTCTTATCTCAACCAATCGCAACCATTCTCTTCTCCACCAATCATAACCCTTCTTTAATTATCTATACCTACTTTCTTAA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	64.00%	3.40%	14.43%	18.13%	NA
All Indica	2759	63.40%	0.00%	12.94%	23.60%	NA
All Japonica	1512	78.00%	10.40%	9.85%	1.65%	NA
Aus	269	4.80%	0.00%	36.43%	58.74%	NA
Indica I	595	35.60%	0.00%	16.13%	48.24%	NA
Indica II	465	72.00%	0.20%	13.55%	14.19%	NA
Indica III	913	76.50%	0.00%	10.51%	13.03%	NA
Indica Intermediate	786	64.20%	0.00%	12.98%	22.77%	NA
Temperate Japonica	767	93.70%	3.10%	2.48%	0.65%	NA
Tropical Japonica	504	68.30%	18.10%	13.29%	0.40%	NA
Japonica Intermediate	241	48.50%	17.80%	26.14%	7.47%	NA
VI/Aromatic	96	20.80%	0.00%	63.54%	15.62%	NA
Intermediate	90	68.90%	3.30%	18.89%	8.89%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0504159174	C -> T	LOC_Os05g07720.1	downstream_gene_variant ; 3279.0bp to feature; MODIFIER	silent_mutation	Average:33.601; most accessible tissue: Minghui63 root, score: 49.234	N	N	N	N
vg0504159174	C -> T	LOC_Os05g07730.1	downstream_gene_variant ; 1878.0bp to feature; MODIFIER	silent_mutation	Average:33.601; most accessible tissue: Minghui63 root, score: 49.234	N	N	N	N
vg0504159174	C -> T	LOC_Os05g07720-LOC_Os05g07730	intergenic_region ; MODIFIER	silent_mutation	Average:33.601; most accessible tissue: Minghui63 root, score: 49.234	N	N	N	N
vg0504159174	C -> DEL	N	N	silent_mutation	Average:33.601; most accessible tissue: Minghui63 root, score: 49.234	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0504159174	NA	2.33E-06	mr1040	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504159174	NA	1.58E-06	mr1213	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504159174	NA	2.57E-14	mr1301	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504159174	5.66E-06	1.75E-15	mr1410	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504159174	NA	6.85E-13	mr1769	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504159174	NA	9.72E-08	mr1951	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504159174	1.41E-06	9.50E-18	mr1301_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504159174	9.82E-07	3.20E-17	mr1410_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504159174	NA	3.77E-06	mr1510_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504159174	NA	2.13E-07	mr1632_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504159174	NA	7.34E-09	mr1676_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251