Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0503762591:

Variant ID: vg0503762591 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 3762591
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.63, T: 0.37, others allele: 0.00, population size: 92. )

Flanking Sequence (100 bp) in Reference Genome:


AAACCAGAATTTGCCAAATTTAAATCTGCTTCTTAAACGCAAATTCAATGTTGACGTACTAGCAATATTAGGCTTAGTTTTTCTTTTTAACTCTAAACTT[T/C]
AACTTCTTTTTTCGTTAACACAATTTTCATACTGTTAAATGATTTTTTTAAAAAAATTTATATACAAGTTATTTAAAAATTCAAATAAATTTATTTATCA

Reverse complement sequence

TGATAAATAAATTTATTTGAATTTTTAAATAACTTGTATATAAATTTTTTTAAAAAAATCATTTAACAGTATGAAAATTGTGTTAACGAAAAAAGAAGTT[A/G]
AAGTTTAGAGTTAAAAAGAAAAACTAAGCCTAATATTGCTAGTACGTCAACATTGAATTTGCGTTTAAGAAGCAGATTTAAATTTGGCAAATTCTGGTTT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 65.80% 33.90% 0.30% 0.00% NA
All Indica  2759 88.70% 11.20% 0.11% 0.00% NA
All Japonica  1512 16.50% 82.90% 0.60% 0.00% NA
Aus  269 99.60% 0.40% 0.00% 0.00% NA
Indica I  595 97.10% 2.70% 0.17% 0.00% NA
Indica II  465 76.80% 23.00% 0.22% 0.00% NA
Indica III  913 91.20% 8.80% 0.00% 0.00% NA
Indica Intermediate  786 86.50% 13.40% 0.13% 0.00% NA
Temperate Japonica  767 2.90% 97.10% 0.00% 0.00% NA
Tropical Japonica  504 40.90% 58.10% 0.99% 0.00% NA
Japonica Intermediate  241 9.10% 89.20% 1.66% 0.00% NA
VI/Aromatic  96 92.70% 7.30% 0.00% 0.00% NA
Intermediate  90 60.00% 37.80% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0503762591 T -> C LOC_Os05g07130.1 upstream_gene_variant ; 522.0bp to feature; MODIFIER silent_mutation Average:95.966; most accessible tissue: Zhenshan97 young leaf, score: 98.602 N N N N
vg0503762591 T -> C LOC_Os05g07130.2 upstream_gene_variant ; 522.0bp to feature; MODIFIER silent_mutation Average:95.966; most accessible tissue: Zhenshan97 young leaf, score: 98.602 N N N N
vg0503762591 T -> C LOC_Os05g07120.1 downstream_gene_variant ; 2802.0bp to feature; MODIFIER silent_mutation Average:95.966; most accessible tissue: Zhenshan97 young leaf, score: 98.602 N N N N
vg0503762591 T -> C LOC_Os05g07120.2 downstream_gene_variant ; 2804.0bp to feature; MODIFIER silent_mutation Average:95.966; most accessible tissue: Zhenshan97 young leaf, score: 98.602 N N N N
vg0503762591 T -> C LOC_Os05g07120-LOC_Os05g07130 intergenic_region ; MODIFIER silent_mutation Average:95.966; most accessible tissue: Zhenshan97 young leaf, score: 98.602 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0503762591 T C -0.01 -0.01 -0.01 -0.01 -0.01 -0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0503762591 NA 9.02E-06 mr1096 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0503762591 NA 1.15E-06 mr1245 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0503762591 NA 8.82E-07 mr1369 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0503762591 NA 2.15E-06 mr1681 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0503762591 NA 2.40E-09 mr1806 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0503762591 NA 1.16E-15 mr1830 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0503762591 9.77E-06 NA mr1085_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0503762591 NA 8.04E-11 mr1216_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0503762591 NA 6.24E-06 mr1233_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0503762591 3.37E-06 NA mr1238_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0503762591 1.27E-09 5.70E-10 mr1238_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0503762591 9.68E-08 4.42E-08 mr1484_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0503762591 8.24E-06 1.73E-06 mr1609_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0503762591 1.96E-06 NA mr1841_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0503762591 5.11E-09 1.80E-10 mr1841_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0503762591 NA 4.31E-20 mr1900_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0503762591 4.41E-06 3.25E-07 mr1900_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251