Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0503062538:

Variant ID: vg0503062538 (JBrowse)	Variation Type: SNP
Chromosome: chr05	Position: 3062538
Reference Allele: T	Alternative Allele: C
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

ATAGAGCAGATAAAATCAGATAATGCGCTTCGGGAAAATATGTAATGCAAATCATAAATGCATTGGAAACTTGGAAACTACCATTGAATCGAGAAATAGA[T/C]
GTCTGGGAGTTAAATTTTAACTTATAGTGACGTGGACGAATCTCGAATGTCCATTTTTTAATCTAGCGATAGTTTGCAAGTTCCCTTGTGTGTGTCTATA

Reverse complement sequence

TATAGACACACACAAGGGAACTTGCAAACTATCGCTAGATTAAAAAATGGACATTCGAGATTCGTCCACGTCACTATAAGTTAAAATTTAACTCCCAGAC[A/G]
TCTATTTCTCGATTCAATGGTAGTTTCCAAGTTTCCAATGCATTTATGATTTGCATTACATATTTTCCCGAAGCGCATTATCTGATTTTATCTGCTCTAT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	36.80%	14.10%	14.37%	34.74%	NA
All Indica	2759	49.00%	0.60%	14.24%	36.21%	NA
All Japonica	1512	20.30%	36.50%	10.71%	32.47%	NA
Aus	269	17.80%	0.00%	39.41%	42.75%	NA
Indica I	595	35.30%	0.20%	13.28%	51.26%	NA
Indica II	465	42.60%	1.70%	13.33%	42.37%	NA
Indica III	913	61.70%	0.40%	14.02%	23.88%	NA
Indica Intermediate	786	48.30%	0.40%	15.78%	35.50%	NA
Temperate Japonica	767	7.20%	65.70%	11.60%	15.51%	NA
Tropical Japonica	504	28.40%	1.20%	7.34%	63.10%	NA
Japonica Intermediate	241	45.20%	17.40%	14.94%	22.41%	NA
VI/Aromatic	96	8.30%	83.30%	2.08%	6.25%	NA
Intermediate	90	28.90%	18.90%	17.78%	34.44%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0503062538	T -> DEL	N	N	silent_mutation	Average:31.828; most accessible tissue: Callus, score: 77.605	N	N	N	N
vg0503062538	T -> C	LOC_Os05g06130.1	upstream_gene_variant ; 315.0bp to feature; MODIFIER	silent_mutation	Average:31.828; most accessible tissue: Callus, score: 77.605	N	N	N	N
vg0503062538	T -> C	LOC_Os05g06120.1	downstream_gene_variant ; 670.0bp to feature; MODIFIER	silent_mutation	Average:31.828; most accessible tissue: Callus, score: 77.605	N	N	N	N
vg0503062538	T -> C	LOC_Os05g06120-LOC_Os05g06130	intergenic_region ; MODIFIER	silent_mutation	Average:31.828; most accessible tissue: Callus, score: 77.605	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0503062538	NA	3.02E-07	mr1042_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0503062538	NA	1.63E-06	mr1045_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0503062538	NA	4.23E-09	mr1189_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0503062538	NA	7.05E-08	mr1502_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0503062538	NA	7.14E-06	mr1588_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0503062538	NA	1.63E-13	mr1722_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0503062538	NA	1.99E-06	mr1722_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0503062538	NA	3.02E-09	mr1769_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0503062538	2.28E-06	2.27E-06	mr1919_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251