| Variant ID: vg0503030079 (JBrowse) | Variation Type: SNP |
| Chromosome: chr05 | Position: 3030079 |
| Reference Allele: T | Alternative Allele: C,A |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
TTTTGTGCGGCTGCTGCTCGGCCATCTCTGCCTCGGGCTTTAATATAATTTTTTTAAAGCAACTTTTCTTTATATTTTTTTTAAAAAACACACTATTTAT[T/C,A]
ATTTTGAAAAATATGCATGTGAAAAATATGGAAGAAGTTGGAAAAATGTTCAAAAGAACCCAACCTAAGAAGTTATAGAGTGTATGTTCCTAACCTCTAC
GTAGAGGTTAGGAACATACACTCTATAACTTCTTAGGTTGGGTTCTTTTGAACATTTTTCCAACTTCTTCCATATTTTTCACATGCATATTTTTCAAAAT[A/G,T]
ATAAATAGTGTGTTTTTTAAAAAAAATATAAAGAAAAGTTGCTTTAAAAAAATTATATTAAAGCCCGAGGCAGAGATGGCCGAGCAGCAGCCGCACAAAA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 65.30% | 33.10% | 0.40% | 1.27% | A: 0.02% |
| All Indica | 2759 | 98.30% | 1.40% | 0.11% | 0.11% | A: 0.04% |
| All Japonica | 1512 | 4.90% | 94.80% | 0.00% | 0.26% | NA |
| Aus | 269 | 89.20% | 10.40% | 0.37% | 0.00% | NA |
| Indica I | 595 | 99.50% | 0.30% | 0.17% | 0.00% | NA |
| Indica II | 465 | 96.60% | 3.20% | 0.00% | 0.22% | NA |
| Indica III | 913 | 98.90% | 0.80% | 0.00% | 0.22% | A: 0.11% |
| Indica Intermediate | 786 | 97.70% | 2.00% | 0.25% | 0.00% | NA |
| Temperate Japonica | 767 | 2.60% | 97.30% | 0.00% | 0.13% | NA |
| Tropical Japonica | 504 | 6.00% | 94.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 10.00% | 88.80% | 0.00% | 1.24% | NA |
| VI/Aromatic | 96 | 13.50% | 16.70% | 15.62% | 54.17% | NA |
| Intermediate | 90 | 50.00% | 48.90% | 0.00% | 1.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0503030079 | T -> DEL | N | N | silent_mutation | Average:63.22; most accessible tissue: Minghui63 panicle, score: 86.85 | N | N | N | N |
| vg0503030079 | T -> A | LOC_Os05g06040.1 | upstream_gene_variant ; 2961.0bp to feature; MODIFIER | silent_mutation | Average:63.22; most accessible tissue: Minghui63 panicle, score: 86.85 | N | N | N | N |
| vg0503030079 | T -> A | LOC_Os05g06050.1 | upstream_gene_variant ; 845.0bp to feature; MODIFIER | silent_mutation | Average:63.22; most accessible tissue: Minghui63 panicle, score: 86.85 | N | N | N | N |
| vg0503030079 | T -> A | LOC_Os05g06040-LOC_Os05g06050 | intergenic_region ; MODIFIER | silent_mutation | Average:63.22; most accessible tissue: Minghui63 panicle, score: 86.85 | N | N | N | N |
| vg0503030079 | T -> C | LOC_Os05g06040.1 | upstream_gene_variant ; 2961.0bp to feature; MODIFIER | silent_mutation | Average:63.22; most accessible tissue: Minghui63 panicle, score: 86.85 | N | N | N | N |
| vg0503030079 | T -> C | LOC_Os05g06050.1 | upstream_gene_variant ; 845.0bp to feature; MODIFIER | silent_mutation | Average:63.22; most accessible tissue: Minghui63 panicle, score: 86.85 | N | N | N | N |
| vg0503030079 | T -> C | LOC_Os05g06040-LOC_Os05g06050 | intergenic_region ; MODIFIER | silent_mutation | Average:63.22; most accessible tissue: Minghui63 panicle, score: 86.85 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0503030079 | NA | 1.07E-16 | mr1116 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0503030079 | 6.18E-06 | NA | mr1119 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0503030079 | NA | 1.22E-10 | mr1172 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0503030079 | NA | 1.14E-17 | mr1529 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0503030079 | 6.92E-06 | NA | mr1936 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0503030079 | 4.39E-06 | 5.90E-06 | mr1936 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0503030079 | NA | 2.74E-06 | mr1020_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0503030079 | NA | 3.38E-12 | mr1258_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0503030079 | NA | 4.57E-13 | mr1496_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0503030079 | NA | 3.29E-25 | mr1588_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |