Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0502914537:

Variant ID: vg0502914537 (JBrowse)	Variation Type: SNP
Chromosome: chr05	Position: 2914537
Reference Allele: T	Alternative Allele: C
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.01, others allele: 0.00, population size: 336. )

Flanking Sequence (100 bp) in Reference Genome:

CTTGAACATTCAGGCACACTCTTGACGATTGGGTTCTGAACTTCTGATTCTTCAGAACTGCAAAAGTGAGCTTTGAACAGTTCATCACCTCTCAGCTGCA[T/C]
TCTGAAGATTGAGTATTATGGTCATAAAACTCATTGTATGGATCTTCTTGACAGAGAGAAAAATTCAGTTTGTCATCAACATTCAGGCACAATCTGAAGA

Reverse complement sequence

TCTTCAGATTGTGCCTGAATGTTGATGACAAACTGAATTTTTCTCTCTGTCAAGAAGATCCATACAATGAGTTTTATGACCATAATACTCAATCTTCAGA[A/G]
TGCAGCTGAGAGGTGATGAACTGTTCAAAGCTCACTTTTGCAGTTCTGAAGAATCAGAAGTTCAGAACCCAATCGTCAAGAGTGTGCCTGAATGTTCAAG

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	86.50%	12.20%	1.33%	0.00%	NA
All Indica	2759	99.50%	0.50%	0.00%	0.00%	NA
All Japonica	1512	60.00%	36.00%	4.03%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	99.80%	0.20%	0.00%	0.00%	NA
Indica II	465	98.30%	1.70%	0.00%	0.00%	NA
Indica III	913	99.80%	0.20%	0.00%	0.00%	NA
Indica Intermediate	786	99.70%	0.30%	0.00%	0.00%	NA
Temperate Japonica	767	31.00%	62.60%	6.39%	0.00%	NA
Tropical Japonica	504	98.00%	1.40%	0.60%	0.00%	NA
Japonica Intermediate	241	72.60%	23.70%	3.73%	0.00%	NA
VI/Aromatic	96	94.80%	5.20%	0.00%	0.00%	NA
Intermediate	90	83.30%	14.40%	2.22%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0502914537	T -> C	LOC_Os05g05810.1	upstream_gene_variant ; 757.0bp to feature; MODIFIER	silent_mutation	Average:84.491; most accessible tissue: Zhenshan97 flower, score: 94.54	N	N	N	N
vg0502914537	T -> C	LOC_Os05g05820.1	upstream_gene_variant ; 1464.0bp to feature; MODIFIER	silent_mutation	Average:84.491; most accessible tissue: Zhenshan97 flower, score: 94.54	N	N	N	N
vg0502914537	T -> C	LOC_Os05g05810.2	upstream_gene_variant ; 763.0bp to feature; MODIFIER	silent_mutation	Average:84.491; most accessible tissue: Zhenshan97 flower, score: 94.54	N	N	N	N
vg0502914537	T -> C	LOC_Os05g05810-LOC_Os05g05820	intergenic_region ; MODIFIER	silent_mutation	Average:84.491; most accessible tissue: Zhenshan97 flower, score: 94.54	N	N	N	N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID	Ref	Alt	Root (RT)	Young Leaf (YL)	Flag Leaf (FL)	Young Panicle (YP)	Lemma & Palea (LP)	Stamen & Pistil (SP)
vg0502914537	T	C	0.03	0.02	0.03	0.03	0.05	0.05

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0502914537	NA	2.46E-08	mr1549	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0502914537	NA	2.02E-06	mr1043_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0502914537	NA	7.39E-06	mr1129_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0502914537	NA	3.33E-12	mr1486_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0502914537	NA	2.10E-07	mr1502_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0502914537	1.94E-06	NA	mr1549_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0502914537	NA	1.36E-06	mr1549_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0502914537	NA	4.94E-06	mr1577_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0502914537	NA	5.97E-26	mr1588_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0502914537	NA	1.11E-07	mr1588_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0502914537	NA	4.07E-09	mr1624_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0502914537	NA	2.45E-08	mr1746_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0502914537	NA	1.04E-06	mr1757_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0502914537	NA	9.11E-06	mr1957_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251