Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0502125341:

Variant ID: vg0502125341 (JBrowse)	Variation Type: SNP
Chromosome: chr05	Position: 2125341
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TCCCTCCATCTACTTTTGATAGTCATATTTCCAAATCTGAAAATTTTATTTTTGATAGGCATATTTCAATCTAACAACCTATCATCTTAATGACTTTCTC[G/A]
GATTTAATGCATAACTCTTCATTCTTCCACACATAATTGGCTACATGGGCATTGAGAAATGTAAATATTAATGAATCGCTTGTTTACGAGGAATGACTAG

Reverse complement sequence

CTAGTCATTCCTCGTAAACAAGCGATTCATTAATATTTACATTTCTCAATGCCCATGTAGCCAATTATGTGTGGAAGAATGAAGAGTTATGCATTAAATC[C/T]
GAGAAAGTCATTAAGATGATAGGTTGTTAGATTGAAATATGCCTATCAAAAATAAAATTTTCAGATTTGGAAATATGACTATCAAAAGTAGATGGAGGGA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	44.40%	0.10%	1.33%	54.13%	NA
All Indica	2759	24.10%	0.30%	1.45%	74.23%	NA
All Japonica	1512	84.50%	0.00%	0.46%	15.01%	NA
Aus	269	5.20%	0.00%	4.83%	89.96%	NA
Indica I	595	2.70%	0.00%	1.34%	95.97%	NA
Indica II	465	18.70%	1.10%	1.51%	78.71%	NA
Indica III	913	44.60%	0.00%	1.53%	53.89%	NA
Indica Intermediate	786	19.60%	0.30%	1.40%	78.75%	NA
Temperate Japonica	767	95.60%	0.00%	0.52%	3.91%	NA
Tropical Japonica	504	71.40%	0.00%	0.40%	28.17%	NA
Japonica Intermediate	241	76.80%	0.00%	0.41%	22.82%	NA
VI/Aromatic	96	87.50%	0.00%	1.04%	11.46%	NA
Intermediate	90	64.40%	0.00%	2.22%	33.33%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0502125341	G -> DEL	N	N	silent_mutation	Average:36.767; most accessible tissue: Minghui63 root, score: 72.958	N	N	N	N
vg0502125341	G -> A	LOC_Os05g04570.1	downstream_gene_variant ; 3911.0bp to feature; MODIFIER	silent_mutation	Average:36.767; most accessible tissue: Minghui63 root, score: 72.958	N	N	N	N
vg0502125341	G -> A	LOC_Os05g04550-LOC_Os05g04570	intergenic_region ; MODIFIER	silent_mutation	Average:36.767; most accessible tissue: Minghui63 root, score: 72.958	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0502125341	6.25E-09	9.08E-14	mr1032	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0502125341	8.40E-08	2.37E-07	mr1032	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0502125341	9.37E-08	NA	mr1165	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0502125341	4.73E-07	1.27E-06	mr1165	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0502125341	6.85E-06	NA	mr1477	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0502125341	2.96E-09	7.80E-14	mr1478	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0502125341	5.45E-08	1.53E-07	mr1478	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0502125341	8.76E-06	NA	mr1971	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251