Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0502095253:

Variant ID: vg0502095253 (JBrowse)	Variation Type: SNP
Chromosome: chr05	Position: 2095253
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.98, T: 0.01, others allele: 0.00, population size: 218. )

Flanking Sequence (100 bp) in Reference Genome:

TGAATCTATCCATGCCACGTGTGTAAATCATGCCATAAGAACTGATATAATTTAATTTTATACCTCCCTGATGTCAAATTATACCCTAGAAATTTTGAAC[C/T]
TTCTAAACCTTCATATTGTTAGATTAATTTTTACCTTAACATAAGCCACGTTAGAGTGGAACCAACTTTTCAGACTCACGCAACGAGCTGCAATGATATT

Reverse complement sequence

AATATCATTGCAGCTCGTTGCGTGAGTCTGAAAAGTTGGTTCCACTCTAACGTGGCTTATGTTAAGGTAAAAATTAATCTAACAATATGAAGGTTTAGAA[G/A]
GTTCAAAATTTCTAGGGTATAATTTGACATCAGGGAGGTATAAAATTAAATTATATCAGTTCTTATGGCATGATTTACACACGTGGCATGGATAGATTCA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	59.60%	40.30%	0.11%	0.00%	NA
All Indica	2759	34.60%	65.20%	0.18%	0.00%	NA
All Japonica	1512	95.70%	4.30%	0.00%	0.00%	NA
Aus	269	96.30%	3.70%	0.00%	0.00%	NA
Indica I	595	3.40%	96.50%	0.17%	0.00%	NA
Indica II	465	25.20%	74.80%	0.00%	0.00%	NA
Indica III	913	60.40%	39.60%	0.00%	0.00%	NA
Indica Intermediate	786	33.80%	65.60%	0.51%	0.00%	NA
Temperate Japonica	767	98.70%	1.30%	0.00%	0.00%	NA
Tropical Japonica	504	93.70%	6.30%	0.00%	0.00%	NA
Japonica Intermediate	241	90.50%	9.50%	0.00%	0.00%	NA
VI/Aromatic	96	97.90%	2.10%	0.00%	0.00%	NA
Intermediate	90	71.10%	28.90%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0502095253	C -> T	LOC_Os05g04520.1	upstream_gene_variant ; 758.0bp to feature; MODIFIER	silent_mutation	Average:65.674; most accessible tissue: Zhenshan97 root, score: 92.392	N	N	N	N
vg0502095253	C -> T	LOC_Os05g04510.1	downstream_gene_variant ; 2911.0bp to feature; MODIFIER	silent_mutation	Average:65.674; most accessible tissue: Zhenshan97 root, score: 92.392	N	N	N	N
vg0502095253	C -> T	LOC_Os05g04510.2	downstream_gene_variant ; 3187.0bp to feature; MODIFIER	silent_mutation	Average:65.674; most accessible tissue: Zhenshan97 root, score: 92.392	N	N	N	N
vg0502095253	C -> T	LOC_Os05g04510-LOC_Os05g04520	intergenic_region ; MODIFIER	silent_mutation	Average:65.674; most accessible tissue: Zhenshan97 root, score: 92.392	N	N	N	N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID	Ref	Alt	Root (RT)	Young Leaf (YL)	Flag Leaf (FL)	Young Panicle (YP)	Lemma & Palea (LP)	Stamen & Pistil (SP)
vg0502095253	C	T	0.04	0.02	0.01	-0.01	0.0	0.0

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0502095253	NA	2.15E-10	mr1712	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0502095253	NA	1.50E-09	mr1770	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0502095253	NA	4.62E-06	mr1842	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0502095253	NA	2.26E-06	mr1113_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0502095253	NA	5.47E-06	mr1114_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0502095253	NA	2.45E-06	mr1117_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0502095253	NA	2.99E-06	mr1119_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0502095253	NA	8.90E-07	mr1120_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0502095253	3.02E-06	4.77E-07	mr1247_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0502095253	NA	1.16E-32	mr1598_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0502095253	NA	4.48E-10	mr1946_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0502095253	9.02E-06	9.02E-06	mr1947_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0502095253	NA	4.48E-10	mr1948_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251