Search for Variation information by Variation ID:
Detailed information for vg0501865585:
| Variant ID: vg0501865585 (JBrowse) | Variation Type: SNP |
| Chromosome: chr05 | Position: 1865585 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, A: 0.00, others allele: 0.00, population size: 304. )
Flanking Sequence (100 bp) in Reference Genome:
TTTTTTGAGGATGGAAAGGTACATGATGCACTTTCTATGTGGCATTGGATGGTGGATGAAGGATGGGCTCCATCAACAATCTCTTACAATGTTCTCATCC[G/A]
TGGCCTTTGCTGCATTGGTGATTTGAAAGGAGCATTAGATTTCTTCAACAGTATGAAAAGAAATGCCCTCCTTCCCAACGCGACTACCTATTCTACGCTT
Reverse complement sequence
AAGCGTAGAATAGGTAGTCGCGTTGGGAAGGAGGGCATTTCTTTTCATACTGTTGAAGAAATCTAATGCTCCTTTCAAATCACCAATGCAGCAAAGGCCA[C/T]
GGATGAGAACATTGTAAGAGATTGTTGATGGAGCCCATCCTTCATCCACCATCCAATGCCACATAGAAAGTGCATCATGTACCTTTCCATCCTCAAAAAA
Allele Frequencies:
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 90.70% | 9.30% | 0.00% | 0.00% | NA |
| All Indica | 2759 | 85.30% | 14.70% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 99.20% | 0.80% | 0.00% | 0.00% | NA |
| Aus | 269 | 94.80% | 5.20% | 0.00% | 0.00% | NA |
| Indica I | 595 | 72.80% | 27.20% | 0.00% | 0.00% | NA |
| Indica II | 465 | 97.00% | 3.00% | 0.00% | 0.00% | NA |
| Indica III | 913 | 84.80% | 15.20% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 88.50% | 11.50% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 99.10% | 0.90% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 99.20% | 0.80% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 95.80% | 4.20% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 93.30% | 6.70% | 0.00% | 0.00% | NA |
Allele Effect:
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0501865585 | G -> A | LOC_Os05g04160.1 | missense_variant ; p.Arg335His; MODERATE | nonsynonymous_codon ; R335H | Average:56.173; most accessible tissue: Zhenshan97 flower, score: 83.709 | probably damaging  |
2.33 |
TOLERATED | 1.00 |
Putative Genotype-Phenotype Associations:
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0501865585 | NA | 4.61E-06 | mr1662 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0501865585 | NA | 4.43E-06 | mr1925 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0501865585 | 4.84E-06 | NA | mr1959 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0501865585 | NA | 3.49E-08 | mr1959 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0501865585 | NA | 3.48E-06 | mr1654_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0501865585 | NA | 6.88E-07 | mr1959_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |