Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0501839750:

Variant ID: vg0501839750 (JBrowse)	Variation Type: SNP
Chromosome: chr05	Position: 1839750
Reference Allele: A	Alternative Allele: G
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

ATCGGCCGACAGGCAGCGGTCAGATCAGCTCTATGAACGAAACCCGACTCTTTTCAAACTTTGGCAATATTCTCCTATTTTAATCCTAAGTGCTAAATTT[A/G]
GGTGTAAACACATGCCTCCTGCCTTTTTGTGAACTTTGTGAACCTAAAAGCATAAAACACGTGATCTTAGGGCAATAATCTAATTGCCGGCCATATAACT

Reverse complement sequence

AGTTATATGGCCGGCAATTAGATTATTGCCCTAAGATCACGTGTTTTATGCTTTTAGGTTCACAAAGTTCACAAAAAGGCAGGAGGCATGTGTTTACACC[T/C]
AAATTTAGCACTTAGGATTAAAATAGGAGAATATTGCCAAAGTTTGAAAAGAGTCGGGTTTCGTTCATAGAGCTGATCTGACCGCTGCCTGTCGGCCGAT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	77.20%	22.70%	0.08%	0.00%	NA
All Indica	2759	97.80%	2.00%	0.14%	0.00%	NA
All Japonica	1512	50.90%	49.10%	0.00%	0.00%	NA
Aus	269	11.90%	88.10%	0.00%	0.00%	NA
Indica I	595	99.20%	0.70%	0.17%	0.00%	NA
Indica II	465	95.10%	4.70%	0.22%	0.00%	NA
Indica III	913	99.50%	0.50%	0.00%	0.00%	NA
Indica Intermediate	786	96.60%	3.20%	0.25%	0.00%	NA
Temperate Japonica	767	27.00%	73.00%	0.00%	0.00%	NA
Tropical Japonica	504	74.60%	25.40%	0.00%	0.00%	NA
Japonica Intermediate	241	77.20%	22.80%	0.00%	0.00%	NA
VI/Aromatic	96	86.50%	13.50%	0.00%	0.00%	NA
Intermediate	90	72.20%	27.80%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0501839750	A -> G	LOC_Os05g04080.1	upstream_gene_variant ; 924.0bp to feature; MODIFIER	silent_mutation	Average:30.645; most accessible tissue: Callus, score: 73.019	N	N	N	N
vg0501839750	A -> G	LOC_Os05g04100.1	upstream_gene_variant ; 3102.0bp to feature; MODIFIER	silent_mutation	Average:30.645; most accessible tissue: Callus, score: 73.019	N	N	N	N
vg0501839750	A -> G	LOC_Os05g04090.1	downstream_gene_variant ; 866.0bp to feature; MODIFIER	silent_mutation	Average:30.645; most accessible tissue: Callus, score: 73.019	N	N	N	N
vg0501839750	A -> G	LOC_Os05g04110.1	downstream_gene_variant ; 4390.0bp to feature; MODIFIER	silent_mutation	Average:30.645; most accessible tissue: Callus, score: 73.019	N	N	N	N
vg0501839750	A -> G	LOC_Os05g04080-LOC_Os05g04090	intergenic_region ; MODIFIER	silent_mutation	Average:30.645; most accessible tissue: Callus, score: 73.019	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0501839750	NA	3.29E-13	mr1013	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501839750	NA	1.72E-11	mr1045	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501839750	NA	3.46E-07	mr1053	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501839750	NA	7.27E-13	mr1056	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501839750	NA	2.00E-06	mr1229	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501839750	NA	7.36E-06	mr1596	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501839750	NA	1.27E-07	mr1666	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501839750	NA	7.09E-07	mr1748	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501839750	NA	1.96E-10	mr1763	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501839750	NA	1.34E-06	mr1880	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501839750	NA	1.04E-08	mr1860_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251