Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0501802982:

Variant ID: vg0501802982 (JBrowse)	Variation Type: SNP
Chromosome: chr05	Position: 1802982
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CGGTCGGAAATGATCGGAAAACAGCCTCAACCATTTCCGTAACCATATTTTTCTCGGAAACGAAATCGGAAACGGTAAAGTCGGAAACGAAAACGATATC[G/A]
GAAATATCGGAAAACCGAAAACGGAACAATACGGACGGAAACATGTCGGTACAGATCGAAAACCGGTAACAAATACGGAAACATTAAACTATAAAAACAT

Reverse complement sequence

ATGTTTTTATAGTTTAATGTTTCCGTATTTGTTACCGGTTTTCGATCTGTACCGACATGTTTCCGTCCGTATTGTTCCGTTTTCGGTTTTCCGATATTTC[C/T]
GATATCGTTTTCGTTTCCGACTTTACCGTTTCCGATTTCGTTTCCGAGAAAAATATGGTTACGGAAATGGTTGAGGCTGTTTTCCGATCATTTCCGACCG

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	38.70%	2.10%	14.92%	44.22%	NA
All Indica	2759	28.20%	3.60%	17.25%	51.00%	NA
All Japonica	1512	52.40%	0.10%	5.95%	41.53%	NA
Aus	269	55.40%	0.00%	38.29%	6.32%	NA
Indica I	595	16.30%	2.50%	25.55%	55.63%	NA
Indica II	465	28.40%	1.30%	17.63%	52.69%	NA
Indica III	913	38.30%	6.10%	12.16%	43.37%	NA
Indica Intermediate	786	25.30%	2.70%	16.67%	55.34%	NA
Temperate Japonica	767	74.10%	0.00%	1.83%	24.12%	NA
Tropical Japonica	504	30.60%	0.00%	8.93%	60.52%	NA
Japonica Intermediate	241	29.50%	0.40%	12.86%	57.26%	NA
VI/Aromatic	96	68.80%	2.10%	26.04%	3.12%	NA
Intermediate	90	48.90%	0.00%	12.22%	38.89%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0501802982	G -> DEL	N	N	silent_mutation	Average:14.352; most accessible tissue: Callus, score: 28.079	N	N	N	N
vg0501802982	G -> A	LOC_Os05g04010.1	upstream_gene_variant ; 2807.0bp to feature; MODIFIER	silent_mutation	Average:14.352; most accessible tissue: Callus, score: 28.079	N	N	N	N
vg0501802982	G -> A	LOC_Os05g04020.1	downstream_gene_variant ; 1200.0bp to feature; MODIFIER	silent_mutation	Average:14.352; most accessible tissue: Callus, score: 28.079	N	N	N	N
vg0501802982	G -> A	LOC_Os05g04010-LOC_Os05g04020	intergenic_region ; MODIFIER	silent_mutation	Average:14.352; most accessible tissue: Callus, score: 28.079	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0501802982	2.10E-07	1.29E-10	mr1514	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501802982	2.41E-06	4.90E-07	mr1514	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501802982	NA	4.70E-06	mr1772	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501802982	NA	1.49E-06	mr1045_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501802982	NA	7.52E-06	mr1906_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501802982	NA	4.94E-06	mr1909_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251