Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0501779982:

Variant ID: vg0501779982 (JBrowse)	Variation Type: SNP
Chromosome: chr05	Position: 1779982
Reference Allele: A	Alternative Allele: G
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CGTGGTCCCGATCGATACCGCTATTGTGGCCGCGAAACCGACACTGGTGGAGAAACCCTTTTTACTCCCAGTTGATAACCCCCTATAGTACTCCCAGTTG[A/G]
TAACCCCCTATAGTTCCGGTTTTTCAACCGAGAGTAAAAATCTGGGACTAAAGATAGTGATCTTTAGTCCCGGTTCAAATACTCAGGACAAAAGATGGAT

Reverse complement sequence

ATCCATCTTTTGTCCTGAGTATTTGAACCGGGACTAAAGATCACTATCTTTAGTCCCAGATTTTTACTCTCGGTTGAAAAACCGGAACTATAGGGGGTTA[T/C]
CAACTGGGAGTACTATAGGGGGTTATCAACTGGGAGTAAAAAGGGTTTCTCCACCAGTGTCGGTTTCGCGGCCACAATAGCGGTATCGATCGGGACCACG

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	84.40%	0.20%	0.61%	14.75%	NA
All Indica	2759	93.30%	0.10%	0.36%	6.31%	NA
All Japonica	1512	65.70%	0.00%	0.46%	33.80%	NA
Aus	269	99.60%	0.40%	0.00%	0.00%	NA
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	95.50%	0.00%	0.43%	4.09%	NA
Indica III	913	85.80%	0.20%	0.66%	13.36%	NA
Indica Intermediate	786	95.50%	0.00%	0.25%	4.20%	NA
Temperate Japonica	767	85.50%	0.00%	0.13%	14.34%	NA
Tropical Japonica	504	43.50%	0.00%	0.99%	55.56%	NA
Japonica Intermediate	241	49.40%	0.00%	0.41%	50.21%	NA
VI/Aromatic	96	81.20%	8.30%	10.42%	0.00%	NA
Intermediate	90	84.40%	0.00%	2.22%	13.33%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0501779982	A -> DEL	N	N	silent_mutation	Average:63.578; most accessible tissue: Minghui63 young leaf, score: 99.571	N	N	N	N
vg0501779982	A -> G	LOC_Os05g03960.1	upstream_gene_variant ; 2159.0bp to feature; MODIFIER	silent_mutation	Average:63.578; most accessible tissue: Minghui63 young leaf, score: 99.571	N	N	N	N
vg0501779982	A -> G	LOC_Os05g03950.1	downstream_gene_variant ; 2323.0bp to feature; MODIFIER	silent_mutation	Average:63.578; most accessible tissue: Minghui63 young leaf, score: 99.571	N	N	N	N
vg0501779982	A -> G	LOC_Os05g03950-LOC_Os05g03960	intergenic_region ; MODIFIER	silent_mutation	Average:63.578; most accessible tissue: Minghui63 young leaf, score: 99.571	N	N	N	N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID	Ref	Alt	Root (RT)	Young Leaf (YL)	Flag Leaf (FL)	Young Panicle (YP)	Lemma & Palea (LP)	Stamen & Pistil (SP)
vg0501779982	A	G	0.0	0.04	0.01	0.02	0.0	-0.01

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0501779982	NA	3.70E-06	mr1322_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501779982	NA	3.75E-08	mr1527_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501779982	NA	8.44E-07	mr1544_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501779982	2.43E-06	NA	mr1578_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501779982	9.34E-07	6.52E-07	mr1578_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501779982	NA	1.99E-06	mr1623_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501779982	4.74E-07	4.03E-07	mr1952_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501779982	1.73E-07	4.09E-11	mr1952_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251