Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0501779691:

Variant ID: vg0501779691 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 1779691
Reference Allele: AAlternative Allele: T
Primary Allele: TSecondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.81, T: 0.19, others allele: 0.00, population size: 69. )

Flanking Sequence (100 bp) in Reference Genome:


AAATTCTAAAATATTTCAAAAAGCTAGCGTGTGTAAAAGATATATGTGTGCGTGACTCTTGTTTTAAATGCACATTGAAAACCGCATGCCTCACAAATTT[A/T]
CATTCACAACGGCACCAGACTTTTGTGCAAAAACAGCGGCCGCTATTAATACCACTAAAAAAACGTGACCTTTCCTAAATTCGATGGTGTCGATTTTCGT

Reverse complement sequence

ACGAAAATCGACACCATCGAATTTAGGAAAGGTCACGTTTTTTTAGTGGTATTAATAGCGGCCGCTGTTTTTGCACAAAAGTCTGGTGCCGTTGTGAATG[T/A]
AAATTTGTGAGGCATGCGGTTTTCAATGTGCATTTAAAACAAGAGTCACGCACACATATATCTTTTACACACGCTAGCTTTTTGAAATATTTTAGAATTT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 52.80% 47.00% 0.13% 0.00% NA
All Indica  2759 67.50% 32.40% 0.18% 0.00% NA
All Japonica  1512 37.30% 62.70% 0.00% 0.00% NA
Aus  269 10.00% 90.00% 0.00% 0.00% NA
Indica I  595 98.50% 1.50% 0.00% 0.00% NA
Indica II  465 69.90% 30.10% 0.00% 0.00% NA
Indica III  913 44.40% 55.30% 0.33% 0.00% NA
Indica Intermediate  786 69.30% 30.40% 0.25% 0.00% NA
Temperate Japonica  767 16.30% 83.70% 0.00% 0.00% NA
Tropical Japonica  504 61.10% 38.90% 0.00% 0.00% NA
Japonica Intermediate  241 54.40% 45.60% 0.00% 0.00% NA
VI/Aromatic  96 4.20% 95.80% 0.00% 0.00% NA
Intermediate  90 45.60% 53.30% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0501779691 A -> T LOC_Os05g03960.1 upstream_gene_variant ; 2450.0bp to feature; MODIFIER silent_mutation Average:63.916; most accessible tissue: Minghui63 young leaf, score: 99.667 N N N N
vg0501779691 A -> T LOC_Os05g03950.1 downstream_gene_variant ; 2032.0bp to feature; MODIFIER silent_mutation Average:63.916; most accessible tissue: Minghui63 young leaf, score: 99.667 N N N N
vg0501779691 A -> T LOC_Os05g03950-LOC_Os05g03960 intergenic_region ; MODIFIER silent_mutation Average:63.916; most accessible tissue: Minghui63 young leaf, score: 99.667 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0501779691 A T 0.02 0.1 0.15 0.03 0.14 0.1

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0501779691 NA 2.84E-06 mr1548 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501779691 5.56E-06 NA mr1030_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501779691 8.90E-07 5.10E-07 mr1030_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501779691 NA 2.42E-06 mr1322_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501779691 NA 5.36E-08 mr1446_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501779691 NA 1.25E-06 mr1527_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501779691 9.80E-06 9.80E-06 mr1542_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501779691 2.31E-06 2.51E-06 mr1578_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501779691 2.37E-06 6.23E-10 mr1754_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501779691 NA 4.86E-06 mr1754_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501779691 NA 1.90E-07 mr1805_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501779691 NA 7.47E-06 mr1902_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501779691 NA 1.93E-06 mr1933_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501779691 9.30E-07 2.67E-09 mr1952_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501779691 NA 6.09E-06 mr1957_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251