Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0501598017:

Variant ID: vg0501598017 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 1598017
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.55, C: 0.45, others allele: 0.00, population size: 76. )

Flanking Sequence (100 bp) in Reference Genome:


TCAGCCTCCAGGAGCCGCGCCACTTCCTCTCGGATGAAGGCCTGCCGCTCCGGGGCTTGACACCGCACTTTTTGCCGGACGGGTCGCGCATCCAGCCGCA[T/C]
GGCGAGGCGGTGCTCGATCACCTCCCTAGGGACCCCGGGCATGTCCGACGGCTTCCATTCGAAGACGTCGGAGTTTGCCCGCAGGAAGGAGACGAGCGCG

Reverse complement sequence

CGCGCTCGTCTCCTTCCTGCGGGCAAACTCCGACGTCTTCGAATGGAAGCCGTCGGACATGCCCGGGGTCCCTAGGGAGGTGATCGAGCACCGCCTCGCC[A/G]
TGCGGCTGGATGCGCGACCCGTCCGGCAAAAAGTGCGGTGTCAAGCCCCGGAGCGGCAGGCCTTCATCCGAGAGGAAGTGGCGCGGCTCCTGGAGGCTGA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 50.60% 40.40% 6.77% 2.20% NA
All Indica  2759 72.20% 13.70% 10.37% 3.73% NA
All Japonica  1512 3.10% 96.60% 0.26% 0.07% NA
Aus  269 89.20% 4.80% 5.95% 0.00% NA
Indica I  595 81.00% 5.50% 10.76% 2.69% NA
Indica II  465 66.00% 14.80% 12.47% 6.67% NA
Indica III  913 69.80% 19.40% 8.11% 2.74% NA
Indica Intermediate  786 72.10% 12.50% 11.45% 3.94% NA
Temperate Japonica  767 1.30% 98.60% 0.13% 0.00% NA
Tropical Japonica  504 5.20% 94.60% 0.20% 0.00% NA
Japonica Intermediate  241 4.60% 94.20% 0.83% 0.41% NA
VI/Aromatic  96 82.30% 8.30% 9.38% 0.00% NA
Intermediate  90 36.70% 57.80% 5.56% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0501598017 T -> DEL N N silent_mutation Average:48.701; most accessible tissue: Zhenshan97 flag leaf, score: 74.825 N N N N
vg0501598017 T -> C LOC_Os05g03670.1 upstream_gene_variant ; 1924.0bp to feature; MODIFIER silent_mutation Average:48.701; most accessible tissue: Zhenshan97 flag leaf, score: 74.825 N N N N
vg0501598017 T -> C LOC_Os05g03680.1 downstream_gene_variant ; 106.0bp to feature; MODIFIER silent_mutation Average:48.701; most accessible tissue: Zhenshan97 flag leaf, score: 74.825 N N N N
vg0501598017 T -> C LOC_Os05g03670-LOC_Os05g03680 intergenic_region ; MODIFIER silent_mutation Average:48.701; most accessible tissue: Zhenshan97 flag leaf, score: 74.825 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0501598017 T C 0.02 0.02 0.01 0.01 0.01 0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0501598017 NA 3.48E-31 mr1298 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501598017 NA 1.91E-13 mr1449 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501598017 NA 8.54E-42 mr1480 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501598017 NA 6.94E-51 mr1692 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501598017 NA 1.79E-27 mr1731 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501598017 NA 5.07E-16 mr1950 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501598017 NA 1.88E-17 mr1968 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501598017 NA 5.07E-06 mr1020_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501598017 NA 2.02E-14 mr1133_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501598017 NA 1.38E-53 mr1141_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501598017 NA 4.10E-19 mr1167_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501598017 NA 8.95E-21 mr1298_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501598017 NA 9.54E-54 mr1480_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501598017 NA 3.32E-11 mr1667_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501598017 NA 1.52E-19 mr1731_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501598017 NA 1.61E-23 mr1968_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251