Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0501368194:

Variant ID: vg0501368194 (JBrowse)	Variation Type: SNP
Chromosome: chr05	Position: 1368194
Reference Allele: T	Alternative Allele: G
Primary Allele: T	Secondary Allele: G

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.99, G: 0.01, others allele: 0.00, population size: 111. )

Flanking Sequence (100 bp) in Reference Genome:

AAATACCGATAATAAAAGGGGACACAAAATGAAATTTACTCTCAAATCTATTAAAAAATACTGAAATTTCATATATAATATGAAACTATGAAAGAAATGT[T/G]
GTGAAATATGGTCTAAATTCAAGAAGTTTCATATGTTTTACTCATAATTTACAGGATTTTCCTTCAATTATATGCAACCTAGCTAGTGCAAAGTGAAACT

Reverse complement sequence

AGTTTCACTTTGCACTAGCTAGGTTGCATATAATTGAAGGAAAATCCTGTAAATTATGAGTAAAACATATGAAACTTCTTGAATTTAGACCATATTTCAC[A/C]
ACATTTCTTTCATAGTTTCATATTATATATGAAATTTCAGTATTTTTTAATAGATTTGAGAGTAAATTTCATTTTGTGTCCCCTTTTATTATCGGTATTT

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	83.00%	12.30%	0.85%	3.85%	NA
All Indica	2759	79.60%	19.90%	0.11%	0.40%	NA
All Japonica	1512	90.50%	1.90%	0.26%	7.34%	NA
Aus	269	72.50%	0.00%	8.18%	19.33%	NA
Indica I	595	94.10%	5.90%	0.00%	0.00%	NA
Indica II	465	83.70%	15.50%	0.22%	0.65%	NA
Indica III	913	66.50%	33.10%	0.00%	0.44%	NA
Indica Intermediate	786	81.60%	17.70%	0.25%	0.51%	NA
Temperate Japonica	767	96.20%	2.70%	0.26%	0.78%	NA
Tropical Japonica	504	87.10%	0.80%	0.20%	11.90%	NA
Japonica Intermediate	241	79.70%	1.20%	0.41%	18.67%	NA
VI/Aromatic	96	84.40%	0.00%	11.46%	4.17%	NA
Intermediate	90	91.10%	4.40%	0.00%	4.44%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0501368194	T -> DEL	N	N	silent_mutation	Average:20.082; most accessible tissue: Minghui63 young leaf, score: 49.581	N	N	N	N
vg0501368194	T -> G	LOC_Os05g03339.1	downstream_gene_variant ; 2577.0bp to feature; MODIFIER	silent_mutation	Average:20.082; most accessible tissue: Minghui63 young leaf, score: 49.581	N	N	N	N
vg0501368194	T -> G	LOC_Os05g03339-LOC_Os05g03350	intergenic_region ; MODIFIER	silent_mutation	Average:20.082; most accessible tissue: Minghui63 young leaf, score: 49.581	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0501368194	NA	4.37E-06	mr1006	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501368194	NA	6.22E-06	mr1136	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501368194	NA	4.06E-09	mr1870	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501368194	NA	1.65E-06	mr1870_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251