Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0501314676:

Variant ID: vg0501314676 (JBrowse)	Variation Type: SNP
Chromosome: chr05	Position: 1314676
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.93, T: 0.07, others allele: 0.00, population size: 90. )

Flanking Sequence (100 bp) in Reference Genome:

TGGAAAAGTTTTAAAAAGTCTTCTTTTGGCTTTGGGCCGAAAGTCGGCCCAAATCTCTCTCTCTCTCTCTCCCTCGGCCCAATCCGGCCCGCAGCTGAGC[C/T]
GCTCGCGTGCGCGTGACCGCCCGCTGACAGGTGGGGCCCACCTGTCAATCTTCGTCTACCTCCAGCCGTCGCCCGGCCGAACCCTAGCCGAGCTGCGCCG

Reverse complement sequence

CGGCGCAGCTCGGCTAGGGTTCGGCCGGGCGACGGCTGGAGGTAGACGAAGATTGACAGGTGGGCCCCACCTGTCAGCGGGCGGTCACGCGCACGCGAGC[G/A]
GCTCAGCTGCGGGCCGGATTGGGCCGAGGGAGAGAGAGAGAGAGAGATTTGGGCCGACTTTCGGCCCAAAGCCAAAAGAAGACTTTTTAAAACTTTTCCA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	74.80%	24.30%	0.89%	0.00%	NA
All Indica	2759	70.70%	29.00%	0.25%	0.00%	NA
All Japonica	1512	89.90%	10.00%	0.07%	0.00%	NA
Aus	269	23.80%	66.50%	9.67%	0.00%	NA
Indica I	595	78.80%	21.20%	0.00%	0.00%	NA
Indica II	465	80.20%	19.40%	0.43%	0.00%	NA
Indica III	913	58.90%	41.00%	0.11%	0.00%	NA
Indica Intermediate	786	72.60%	26.80%	0.51%	0.00%	NA
Temperate Japonica	767	88.90%	11.10%	0.00%	0.00%	NA
Tropical Japonica	504	98.40%	1.60%	0.00%	0.00%	NA
Japonica Intermediate	241	75.50%	24.10%	0.41%	0.00%	NA
VI/Aromatic	96	90.60%	2.10%	7.29%	0.00%	NA
Intermediate	90	82.20%	16.70%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0501314676	C -> T	LOC_Os05g03240.1	downstream_gene_variant ; 3086.0bp to feature; MODIFIER	silent_mutation	Average:32.767; most accessible tissue: Minghui63 panicle, score: 62.157	N	N	N	N
vg0501314676	C -> T	LOC_Os05g03260.1	downstream_gene_variant ; 2546.0bp to feature; MODIFIER	silent_mutation	Average:32.767; most accessible tissue: Minghui63 panicle, score: 62.157	N	N	N	N
vg0501314676	C -> T	LOC_Os05g03250.1	intron_variant ; MODIFIER	silent_mutation	Average:32.767; most accessible tissue: Minghui63 panicle, score: 62.157	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0501314676	NA	7.83E-07	mr1201	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501314676	NA	1.08E-06	mr1201	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501314676	NA	1.06E-06	mr1219	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501314676	NA	3.65E-06	mr1219	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501314676	2.20E-06	3.96E-07	mr1274	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501314676	NA	1.88E-06	mr1274	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501314676	NA	3.15E-07	mr1201_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501314676	NA	1.77E-07	mr1219_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501314676	NA	7.65E-06	mr1219_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501314676	NA	2.69E-06	mr1274_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251