Variant ID: vg0501188064 (JBrowse) | Variation Type: SNP |
Chromosome: chr05 | Position: 1188064 |
Reference Allele: C | Alternative Allele: G |
Primary Allele: C | Secondary Allele: G |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 227. )
CCTTTATATATCTGAAACTTATACACATTATATAGAAAATACTGCAATACATTAAAGTTTACCTCTCATAGCTCATTGTATAGATGTATTTAAAGGCCCA[C/G]
TAAAATCCATACATTTCAGAATATCTTAGAAGTTTAATTTTTCAAATCTGCTAAAAAATAAATATGGGAGTAACATTTATCATACATGTAGCCACATATT
AATATGTGGCTACATGTATGATAAATGTTACTCCCATATTTATTTTTTAGCAGATTTGAAAAATTAAACTTCTAAGATATTCTGAAATGTATGGATTTTA[G/C]
TGGGCCTTTAAATACATCTATACAATGAGCTATGAGAGGTAAACTTTAATGTATTGCAGTATTTTCTATATAATGTGTATAAGTTTCAGATATATAAAGG
Populations | Population Size | Frequency of C(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
---|---|---|---|---|---|---|
All | 4726 | 90.10% | 9.90% | 0.00% | 0.00% | NA |
All Indica | 2759 | 91.00% | 9.00% | 0.00% | 0.00% | NA |
All Japonica | 1512 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
Aus | 269 | 24.50% | 75.50% | 0.00% | 0.00% | NA |
Indica I | 595 | 96.80% | 3.20% | 0.00% | 0.00% | NA |
Indica II | 465 | 94.60% | 5.40% | 0.00% | 0.00% | NA |
Indica III | 913 | 84.80% | 15.20% | 0.00% | 0.00% | NA |
Indica Intermediate | 786 | 91.60% | 8.40% | 0.00% | 0.00% | NA |
Temperate Japonica | 767 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Japonica Intermediate | 241 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
VI/Aromatic | 96 | 91.70% | 8.30% | 0.00% | 0.00% | NA |
Intermediate | 90 | 96.70% | 3.30% | 0.00% | 0.00% | NA |
Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
---|---|---|---|---|---|---|---|---|---|
vg0501188064 | C -> G | LOC_Os05g03050.1 | intron_variant ; MODIFIER | silent_mutation | Average:30.509; most accessible tissue: Callus, score: 75.843 | N | N | N | N |
Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
---|---|---|---|---|---|---|
vg0501188064 | NA | 8.24E-06 | mr1561 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0501188064 | 6.16E-06 | 3.09E-09 | mr1807 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0501188064 | NA | 4.37E-06 | mr1098_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0501188064 | NA | 4.94E-07 | mr1144_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0501188064 | NA | 3.93E-07 | mr1181_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0501188064 | NA | 6.23E-08 | mr1676_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0501188064 | NA | 8.66E-06 | mr1768_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0501188064 | NA | 4.45E-08 | mr1970_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0501188064 | NA | 4.86E-09 | mr1973_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |