Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0501127004:

Variant ID: vg0501127004 (JBrowse)	Variation Type: SNP
Chromosome: chr05	Position: 1127004
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.98, T: 0.01, others allele: 0.00, population size: 286. )

Flanking Sequence (100 bp) in Reference Genome:

GTGATTCCAGCATCCTGAAATCTGAACCTTCGGGAACCCCATATCGAAGCAGCTGGATGATTGTACCATTCTTTTTAAAATGTTGAACACTTGCAGAGAA[C/T]
TCATATGTTGCAAGGGATTTCAGATAATGCTCTCAGACCCACGAATCACAACAGTTTAATATAACCACATAATAAGGATCAGTAGCTAAACGAACCAAAA

Reverse complement sequence

TTTTGGTTCGTTTAGCTACTGATCCTTATTATGTGGTTATATTAAACTGTTGTGATTCGTGGGTCTGAGAGCATTATCTGAAATCCCTTGCAACATATGA[G/A]
TTCTCTGCAAGTGTTCAACATTTTAAAAAGAATGGTACAATCATCCAGCTGCTTCGATATGGGGTTCCCGAAGGTTCAGATTTCAGGATGCTGGAATCAC

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	74.30%	25.50%	0.15%	0.11%	NA
All Indica	2759	57.60%	42.10%	0.14%	0.18%	NA
All Japonica	1512	98.30%	1.70%	0.07%	0.00%	NA
Aus	269	98.90%	1.10%	0.00%	0.00%	NA
Indica I	595	70.10%	29.70%	0.17%	0.00%	NA
Indica II	465	54.60%	44.70%	0.22%	0.43%	NA
Indica III	913	49.00%	50.70%	0.22%	0.11%	NA
Indica Intermediate	786	59.90%	39.80%	0.00%	0.25%	NA
Temperate Japonica	767	97.70%	2.30%	0.00%	0.00%	NA
Tropical Japonica	504	98.80%	1.00%	0.20%	0.00%	NA
Japonica Intermediate	241	99.20%	0.80%	0.00%	0.00%	NA
VI/Aromatic	96	99.00%	1.00%	0.00%	0.00%	NA
Intermediate	90	82.20%	15.60%	2.22%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0501127004	C -> T	LOC_Os05g03000.1	downstream_gene_variant ; 7.0bp to feature; MODIFIER	silent_mutation	Average:51.364; most accessible tissue: Callus, score: 80.538	N	N	N	N
vg0501127004	C -> T	LOC_Os05g03000.2	downstream_gene_variant ; 7.0bp to feature; MODIFIER	silent_mutation	Average:51.364; most accessible tissue: Callus, score: 80.538	N	N	N	N
vg0501127004	C -> T	LOC_Os05g02990-LOC_Os05g03000	intergenic_region ; MODIFIER	silent_mutation	Average:51.364; most accessible tissue: Callus, score: 80.538	N	N	N	N
vg0501127004	C -> DEL	N	N	silent_mutation	Average:51.364; most accessible tissue: Callus, score: 80.538	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0501127004	NA	8.50E-07	mr1588	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501127004	NA	4.07E-06	mr1630	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501127004	NA	4.19E-06	mr1693	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501127004	NA	3.45E-06	mr1729	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501127004	NA	8.73E-06	mr1783	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501127004	NA	2.84E-07	mr1815	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501127004	NA	8.45E-08	mr1815	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501127004	NA	4.92E-07	mr1925	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501127004	NA	6.52E-07	mr1498_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501127004	NA	1.44E-06	mr1679_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251