RiceVarMap2

Search for Variation information by Variation ID:

Detailed information for vg0500829493:

Variant ID: vg0500829493 (JBrowse)	Variation Type: SNP
Chromosome: chr05	Position: 829493
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GACACCATCGACTTTTTAACAAACATTTGTCCATTCATCTTATTCAAATTCTTTTATGCAAATATAAAAAAAAATAAGTCATGCTTAAAGAATATTTGAA[G/A]
ATAAATCAAGTCACAATAAAATAAATAATAATTATATGTATTTTTTGAATAATACAAATGGTCAAATGTATCCCAAAAAGTCAACGGTGTCATATATTAA

Reverse complement sequence

TTAATATATGACACCGTTGACTTTTTGGGATACATTTGACCATTTGTATTATTCAAAAAATACATATAATTATTATTTATTTTATTGTGACTTGATTTAT[C/T]
TTCAAATATTCTTTAAGCATGACTTATTTTTTTTTATATTTGCATAAAAGAATTTGAATAAGATGAATGGACAAATGTTTGTTAAAAAGTCGATGGTGTC

Allele Frequencies:

Search:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	93.10%	6.70%	0.21%	0.00%	NA
All Indica	2759	99.80%	0.20%	0.00%	0.00%	NA
All Japonica	1512	79.50%	19.90%	0.60%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	99.60%	0.40%	0.00%	0.00%	NA
Indica III	913	99.90%	0.10%	0.00%	0.00%	NA
Indica Intermediate	786	99.60%	0.40%	0.00%	0.00%	NA
Temperate Japonica	767	95.70%	3.70%	0.65%	0.00%	NA
Tropical Japonica	504	52.20%	47.00%	0.79%	0.00%	NA
Japonica Intermediate	241	85.10%	14.90%	0.00%	0.00%	NA
VI/Aromatic	96	97.90%	2.10%	0.00%	0.00%	NA
Intermediate	90	90.00%	8.90%	1.11%	0.00%	NA

Showing 1 to 13 of 13 entries

Allele Effect:

Search:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0500829493	G -> A	LOC_Os05g02435.1	downstream_gene_variant ; 3353.0bp to feature; MODIFIER	silent_mutation	Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125	N	N	N	N
vg0500829493	G -> A	LOC_Os05g02440.1	downstream_gene_variant ; 1959.0bp to feature; MODIFIER	silent_mutation	Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125	N	N	N	N
vg0500829493	G -> A	LOC_Os05g02435-LOC_Os05g02440	intergenic_region ; MODIFIER	silent_mutation	Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125	N	N	N	N

Showing 1 to 3 of 3 entries

Putative Genotype-Phenotype Associations:

Show entries

Search:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0500829493	NA	8.76E-15	mr1016	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500829493	NA	2.14E-15	mr1017	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500829493	1.60E-07	NA	mr1018	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500829493	NA	5.78E-13	mr1018	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500829493	8.22E-09	NA	mr1019	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500829493	NA	5.57E-13	mr1019	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500829493	NA	7.29E-09	mr1022	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500829493	3.48E-06	NA	mr1055	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500829493	NA	3.10E-18	mr1055	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500829493	NA	3.32E-13	mr1079	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251

Showing 1 to 10 of 52 entries

Previous1 2 3 4 5 6Next

Search for Variation information by Variation ID:

Detailed information for vg0500829493:

Flanking Sequence (100 bp) in Reference Genome:

Reverse complement sequence

Allele Frequencies:

Allele Effect:

Putative Genotype-Phenotype Associations:

RiceVarMap v2.0

Tools

Blast

Design Primer by Variation ID

Design Primer by Region

Haplotype Network Analysis

Varitation Coordinate Convert

Contact