Variant ID: vg0500689055 (JBrowse) | Variation Type: SNP |
Chromosome: chr05 | Position: 689055 |
Reference Allele: C | Alternative Allele: G |
Primary Allele: C | Secondary Allele: G |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 345. )
TTAGCTAGAAGGGATAAATGTCACCATGTCAGCATGTTCCACATTCACATTTTATTTCTCCTCATGAGCTTCTCGCCTTGTAAAACACCTCACAATGATT[C/G]
AACACAGAAAAACTCAAGAGTCACAATGATGTCAGAGAAAACTACACATAGTGATCAGTGGAACACCTGATGAAAAGAATTGAACACAAGGAGAGTTTTT
AAAAACTCTCCTTGTGTTCAATTCTTTTCATCAGGTGTTCCACTGATCACTATGTGTAGTTTTCTCTGACATCATTGTGACTCTTGAGTTTTTCTGTGTT[G/C]
AATCATTGTGAGGTGTTTTACAAGGCGAGAAGCTCATGAGGAGAAATAAAATGTGAATGTGGAACATGCTGACATGGTGACATTTATCCCTTCTAGCTAA
Populations | Population Size | Frequency of C(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
---|---|---|---|---|---|---|
All | 4726 | 94.50% | 5.10% | 0.42% | 0.00% | NA |
All Indica | 2759 | 99.70% | 0.20% | 0.04% | 0.00% | NA |
All Japonica | 1512 | 83.70% | 15.10% | 1.12% | 0.00% | NA |
Aus | 269 | 99.30% | 0.70% | 0.00% | 0.00% | NA |
Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Indica II | 465 | 99.40% | 0.40% | 0.22% | 0.00% | NA |
Indica III | 913 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
Indica Intermediate | 786 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
Temperate Japonica | 767 | 95.70% | 3.70% | 0.65% | 0.00% | NA |
Tropical Japonica | 504 | 65.30% | 32.90% | 1.79% | 0.00% | NA |
Japonica Intermediate | 241 | 84.20% | 14.50% | 1.24% | 0.00% | NA |
VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Intermediate | 90 | 95.60% | 2.20% | 2.22% | 0.00% | NA |
Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
---|---|---|---|---|---|---|---|---|---|
vg0500689055 | C -> G | LOC_Os05g02180.1 | downstream_gene_variant ; 2384.0bp to feature; MODIFIER | silent_mutation | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
vg0500689055 | C -> G | LOC_Os05g02200.1 | downstream_gene_variant ; 1701.0bp to feature; MODIFIER | silent_mutation | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
vg0500689055 | C -> G | LOC_Os05g02190.1 | intron_variant ; MODIFIER | silent_mutation | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
---|---|---|---|---|---|---|
vg0500689055 | NA | 1.53E-08 | mr1248 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0500689055 | NA | 7.97E-07 | mr1425 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0500689055 | NA | 1.55E-10 | mr1769 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0500689055 | NA | 1.07E-12 | mr1769 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0500689055 | NA | 3.11E-08 | mr1039_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0500689055 | NA | 6.40E-06 | mr1194_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0500689055 | NA | 1.65E-06 | mr1510_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0500689055 | NA | 8.16E-11 | mr1632_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0500689055 | NA | 2.61E-07 | mr1696_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0500689055 | NA | 2.43E-10 | mr1769_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |