Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0500663400:

Variant ID: vg0500663400 (JBrowse)	Variation Type: INDEL
Chromosome: chr05	Position: 663400
Reference Allele: T	Alternative Allele: C,TCCTCTAC
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, others allele: 0.00, population size: 236. )

Flanking Sequence (100 bp) in Reference Genome:

GTACAAGCTAGGGTTGGGTGTCCTTACTCTCCCTTCTTTTTTTTCCTCACTGGACGTCCACTCCCCTTTTATACTTTAAGGGGTTATTACATGAGTTCTA[T/C,TCCTCTAC]
GCGTCCTCTAGTAAGAGAAGAAACATCCTCTAGATTGAACGCGTGTCTCGCGCTGCATGCGCTACAGCTTGGAAATTCCCTACATCAGTAGTCGAGCGGG

Reverse complement sequence

CCCGCTCGACTACTGATGTAGGGAATTTCCAAGCTGTAGCGCATGCAGCGCGAGACACGCGTTCAATCTAGAGGATGTTTCTTCTCTTACTAGAGGACGC[A/G,GTAGAGGA]
TAGAACTCATGTAATAACCCCTTAAAGTATAAAAGGGGAGTGGACGTCCAGTGAGGAAAAAAAAGAAGGGAGAGTAAGGACACCCAACCCTAGCTTGTAC

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	64.10%	33.70%	0.34%	0.00%	TCCTCTAC: 1.88%
All Indica	2759	55.70%	43.40%	0.36%	0.00%	TCCTCTAC: 0.54%
All Japonica	1512	91.30%	8.50%	0.13%	0.00%	NA
Aus	269	11.90%	61.00%	1.12%	0.00%	TCCTCTAC: 26.02%
Indica I	595	79.80%	19.70%	0.50%	0.00%	NA
Indica II	465	74.80%	23.40%	0.00%	0.00%	TCCTCTAC: 1.72%
Indica III	913	25.00%	74.80%	0.11%	0.00%	TCCTCTAC: 0.11%
Indica Intermediate	786	61.80%	36.60%	0.76%	0.00%	TCCTCTAC: 0.76%
Temperate Japonica	767	99.90%	0.10%	0.00%	0.00%	NA
Tropical Japonica	504	78.60%	21.20%	0.20%	0.00%	NA
Japonica Intermediate	241	90.90%	8.70%	0.41%	0.00%	NA
VI/Aromatic	96	13.50%	85.40%	1.04%	0.00%	NA
Intermediate	90	72.20%	23.30%	0.00%	0.00%	TCCTCTAC: 4.44%

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0500663400	T -> TCCTCTAC	LOC_Os05g02150.1	upstream_gene_variant ; 3146.0bp to feature; MODIFIER	silent_mutation	Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125	N	N	N	N
vg0500663400	T -> TCCTCTAC	LOC_Os05g02150-LOC_Os05g02160	intergenic_region ; MODIFIER	silent_mutation	Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125	N	N	N	N
vg0500663400	T -> C	LOC_Os05g02150.1	upstream_gene_variant ; 3145.0bp to feature; MODIFIER	silent_mutation	Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125	N	N	N	N
vg0500663400	T -> C	LOC_Os05g02150-LOC_Os05g02160	intergenic_region ; MODIFIER	silent_mutation	Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0500663400	NA	6.68E-06	mr1195	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500663400	NA	1.63E-06	mr1306	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500663400	NA	5.81E-10	mr1352	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500663400	NA	9.96E-09	mr1546	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500663400	NA	9.97E-09	mr1570	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500663400	NA	4.60E-06	mr1740	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500663400	NA	2.25E-06	mr1751	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500663400	NA	1.28E-07	mr1803	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500663400	NA	1.61E-07	mr1792_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251