Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0500436456:

Variant ID: vg0500436456 (JBrowse)	Variation Type: SNP
Chromosome: chr05	Position: 436456
Reference Allele: T	Alternative Allele: A
Primary Allele: T	Secondary Allele: A

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.00, others allele: 0.00, population size: 281. )

Flanking Sequence (100 bp) in Reference Genome:

TGTGTGTGGAGCGGCAACTAGTGGTTATTGGTGGTCTAAGGAGTTTGCCGTTGATACAATCCCCAACCTTGTTTGTTGCATTTTTTTTCTCTGAGTACTA[T/A]
CAATATATTTGTCCATCAATAATCATAAAGAAATAGCTAGTTTTAAAGTAGTAAAAAAATTGAGATAAAGGTGGAGTACTCGAGTAGGGATGAAAACGCT

Reverse complement sequence

AGCGTTTTCATCCCTACTCGAGTACTCCACCTTTATCTCAATTTTTTTACTACTTTAAAACTAGCTATTTCTTTATGATTATTGATGGACAAATATATTG[A/T]
TAGTACTCAGAGAAAAAAAATGCAACAAACAAGGTTGGGGATTGTATCAACGGCAAACTCCTTAGACCACCAATAACCACTAGTTGCCGCTCCACACACA

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	91.80%	5.90%	1.31%	1.02%	NA
All Indica	2759	89.40%	6.70%	2.17%	1.70%	NA
All Japonica	1512	96.80%	3.10%	0.07%	0.07%	NA
Aus	269	85.90%	14.10%	0.00%	0.00%	NA
Indica I	595	83.40%	13.80%	2.18%	0.67%	NA
Indica II	465	97.00%	0.00%	1.72%	1.29%	NA
Indica III	913	92.80%	1.80%	2.41%	3.07%	NA
Indica Intermediate	786	85.50%	11.20%	2.16%	1.15%	NA
Temperate Japonica	767	94.00%	6.00%	0.00%	0.00%	NA
Tropical Japonica	504	100.00%	0.00%	0.00%	0.00%	NA
Japonica Intermediate	241	98.80%	0.40%	0.41%	0.41%	NA
VI/Aromatic	96	99.00%	1.00%	0.00%	0.00%	NA
Intermediate	90	92.20%	6.70%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0500436456	T -> DEL	N	N	silent_mutation	Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125	N	N	N	N
vg0500436456	T -> A	LOC_Os05g01700.1	upstream_gene_variant ; 4720.0bp to feature; MODIFIER	silent_mutation	Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125	N	N	N	N
vg0500436456	T -> A	LOC_Os05g01710.1	upstream_gene_variant ; 557.0bp to feature; MODIFIER	silent_mutation	Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125	N	N	N	N
vg0500436456	T -> A	LOC_Os05g01710.3	upstream_gene_variant ; 554.0bp to feature; MODIFIER	silent_mutation	Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125	N	N	N	N
vg0500436456	T -> A	LOC_Os05g01710.2	upstream_gene_variant ; 557.0bp to feature; MODIFIER	silent_mutation	Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125	N	N	N	N
vg0500436456	T -> A	LOC_Os05g01700-LOC_Os05g01710	intergenic_region ; MODIFIER	silent_mutation	Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0500436456	NA	1.69E-06	mr1066	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500436456	2.45E-06	2.14E-08	mr1126	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500436456	NA	5.88E-06	mr1457	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500436456	NA	1.04E-07	mr1458	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500436456	NA	8.70E-06	mr1513	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500436456	NA	2.07E-06	mr1525	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500436456	1.99E-06	2.00E-06	mr1673	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500436456	NA	8.93E-06	mr1974	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500436456	NA	3.05E-07	mr1380_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500436456	NA	2.11E-07	mr1458_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500436456	NA	1.32E-07	mr1533_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500436456	NA	7.15E-07	mr1561_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500436456	NA	3.00E-07	mr1875_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500436456	NA	5.14E-06	mr1875_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500436456	NA	4.81E-06	mr1908_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500436456	NA	8.15E-06	mr1908_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500436456	NA	9.70E-07	mr1996_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500436456	NA	2.23E-06	mr1996_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251