Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0500279211:

Variant ID: vg0500279211 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 279211
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, T: 0.01, others allele: 0.00, population size: 117. )

Flanking Sequence (100 bp) in Reference Genome:


TATTTTTCTATTATAATATATATAATAAATAAATGCATATTTATTTTTATTATAGTGTTTTGAAAGAAAAATCTATATATGTTTTTCTAGTTTCTTTAAA[C/T]
TAAATATTTTTAAAGTTATTGATGGTCAAAGTTATAAAAGTTTAATCTCAACTTTATCCAAAACGTCAATTAATATATAACCAGAAGGAGTATATACTTT

Reverse complement sequence

AAAGTATATACTCCTTCTGGTTATATATTAATTGACGTTTTGGATAAAGTTGAGATTAAACTTTTATAACTTTGACCATCAATAACTTTAAAAATATTTA[G/A]
TTTAAAGAAACTAGAAAAACATATATAGATTTTTCTTTCAAAACACTATAATAAAAATAAATATGCATTTATTTATTATATATATTATAATAGAAAAATA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 66.30% 33.40% 0.25% 0.00% NA
All Indica  2759 49.30% 50.40% 0.33% 0.00% NA
All Japonica  1512 96.90% 3.10% 0.00% 0.00% NA
Aus  269 56.90% 42.00% 1.12% 0.00% NA
Indica I  595 17.80% 82.20% 0.00% 0.00% NA
Indica II  465 50.80% 48.80% 0.43% 0.00% NA
Indica III  913 69.00% 30.80% 0.22% 0.00% NA
Indica Intermediate  786 49.20% 50.10% 0.64% 0.00% NA
Temperate Japonica  767 94.80% 5.20% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 97.10% 2.90% 0.00% 0.00% NA
VI/Aromatic  96 91.70% 8.30% 0.00% 0.00% NA
Intermediate  90 76.70% 23.30% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0500279211 C -> T LOC_Os05g01470.1 upstream_gene_variant ; 1151.0bp to feature; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg0500279211 C -> T LOC_Os05g01470.2 upstream_gene_variant ; 4573.0bp to feature; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg0500279211 C -> T LOC_Os05g01470.3 upstream_gene_variant ; 1151.0bp to feature; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg0500279211 C -> T LOC_Os05g01470-LOC_Os05g01480 intergenic_region ; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0500279211 NA 1.21E-06 mr1106 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500279211 NA 1.32E-06 mr1215 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500279211 NA 2.50E-06 mr1318 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500279211 NA 2.79E-09 mr1352 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500279211 3.98E-06 NA mr1358 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500279211 4.40E-06 9.60E-07 mr1413 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500279211 NA 4.80E-06 mr1511 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500279211 NA 4.74E-08 mr1514 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500279211 NA 1.50E-06 mr1516 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500279211 8.43E-08 NA mr1630 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500279211 NA 3.72E-06 mr1630 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500279211 NA 8.71E-06 mr1669 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500279211 NA 1.97E-06 mr1691 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500279211 NA 5.48E-06 mr1693 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500279211 NA 8.16E-07 mr1728 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500279211 NA 2.45E-06 mr1811 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500279211 5.26E-06 NA mr1815 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500279211 9.85E-07 NA mr1821 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251