Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0435191414:

Variant ID: vg0435191414 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 35191414
Reference Allele: AAlternative Allele: T
Primary Allele: TSecondary Allele: A

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.98, A: 0.02, others allele: 0.00, population size: 236. )

Flanking Sequence (100 bp) in Reference Genome:


TCAAATCGGCAAAGCCAAAAAAGCAAGCCCTTCATGCGACCGAGTTTCTTCAAATGAATCAGTCGATTTTATGCCATTGAGCTTCGTGCACACACCAACC[A/T]
AACCCATTCCTATCCTCCCAACACAATCCCACCGCCACCGGCCACTCGTCCAAATAGTTACGCTCCTCCATCTACGCCGTCTCTCTCTACCCAGTCCACA

Reverse complement sequence

TGTGGACTGGGTAGAGAGAGACGGCGTAGATGGAGGAGCGTAACTATTTGGACGAGTGGCCGGTGGCGGTGGGATTGTGTTGGGAGGATAGGAATGGGTT[T/A]
GGTTGGTGTGTGCACGAAGCTCAATGGCATAAAATCGACTGATTCATTTGAAGAAACTCGGTCGCATGAAGGGCTTGCTTTTTTGGCTTTGCCGATTTGA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 62.10% 37.60% 0.02% 0.21% NA
All Indica  2759 94.70% 4.90% 0.04% 0.33% NA
All Japonica  1512 1.10% 98.90% 0.00% 0.00% NA
Aus  269 96.30% 3.70% 0.00% 0.00% NA
Indica I  595 95.80% 3.90% 0.00% 0.34% NA
Indica II  465 98.30% 1.30% 0.00% 0.43% NA
Indica III  913 94.90% 4.80% 0.00% 0.33% NA
Indica Intermediate  786 91.60% 8.00% 0.13% 0.25% NA
Temperate Japonica  767 0.30% 99.70% 0.00% 0.00% NA
Tropical Japonica  504 2.40% 97.60% 0.00% 0.00% NA
Japonica Intermediate  241 1.20% 98.80% 0.00% 0.00% NA
VI/Aromatic  96 16.70% 83.30% 0.00% 0.00% NA
Intermediate  90 34.40% 64.40% 0.00% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0435191414 A -> DEL N N silent_mutation Average:66.907; most accessible tissue: Zhenshan97 young leaf, score: 91.899 N N N N
vg0435191414 A -> T LOC_Os04g59150.1 upstream_gene_variant ; 2076.0bp to feature; MODIFIER silent_mutation Average:66.907; most accessible tissue: Zhenshan97 young leaf, score: 91.899 N N N N
vg0435191414 A -> T LOC_Os04g59150.2 upstream_gene_variant ; 2227.0bp to feature; MODIFIER silent_mutation Average:66.907; most accessible tissue: Zhenshan97 young leaf, score: 91.899 N N N N
vg0435191414 A -> T LOC_Os04g59160.1 downstream_gene_variant ; 780.0bp to feature; MODIFIER silent_mutation Average:66.907; most accessible tissue: Zhenshan97 young leaf, score: 91.899 N N N N
vg0435191414 A -> T LOC_Os04g59150-LOC_Os04g59160 intergenic_region ; MODIFIER silent_mutation Average:66.907; most accessible tissue: Zhenshan97 young leaf, score: 91.899 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0435191414 A T -0.05 -0.13 -0.1 0.05 -0.03 0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0435191414 2.91E-06 NA mr1127 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0435191414 NA 6.66E-08 mr1162 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0435191414 NA 9.01E-11 mr1630 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0435191414 NA 2.99E-42 mr1645 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0435191414 NA 4.19E-35 mr1647 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0435191414 NA 6.40E-14 mr1653 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0435191414 NA 1.19E-37 mr1682 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0435191414 NA 8.72E-10 mr1722 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0435191414 NA 5.99E-21 mr1754 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0435191414 NA 1.08E-15 mr1842 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0435191414 NA 2.94E-69 mr1865 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0435191414 NA 4.45E-32 mr1081_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0435191414 NA 6.20E-13 mr1128_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0435191414 NA 1.48E-07 mr1205_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0435191414 NA 1.54E-22 mr1242_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0435191414 NA 9.48E-07 mr1275_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0435191414 NA 1.05E-12 mr1521_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0435191414 NA 1.15E-09 mr1646_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0435191414 NA 6.03E-07 mr1824_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251